OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

CD147 (BSG) (NM_198589) Human Untagged Clone

Be the first to review this product
SKU
SC126562
BSG (untagged)-Human basigin (Ok blood group) (BSG), transcript variant 2
  $300.00
In Stock*
Bulk Requests & Clone Modifications

Frequently Bought Together (4)

TA501189 BSG (CD147) mouse monoclonal antibody, clone OTI10E10 (formerly 10E10) 100 ul
$447.00
CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "CD147 or NM_198589"

Specifications
Specifications
Product Data
Type Human Untagged Clone
Target Symbol CD147
Synonyms 5F7; CD147; EMMPRIN; EMPRIN; HAb18G; OK; SLC7A11; TCSF
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
Fully Sequenced ORF
>OriGene ORF within SC126562 sequence for NM_198589 edited (data generated by NextGen Sequencing)
ATGGCGGCTGCGCTGTTCGTGCTGCTGGGATTCGCGCTGCTGGGCACCCACGGAGCCTCC
GGGGCTGCCGGCACAGTCTTCACTACCGTAGAAGACCTTGGCTCCAAGATACTCCTCACC
TGCTCCTTGAATGACAGCGCCACAGAGGTCACAGGGCACCGCTGGCTGAAGGGGGGCGTG
GTGCTGAAGGAGGACGCGCTGCCCGGCCAGAAAACGGAGTTCAAGGTGGACTCCGACGAC
CAGTGGGGAGAGTACTCCTGCGTCTTCCTCCCCGAGCCCATGGGCACGGCCAACATCCAG
CTCCACGGGCCTCCCAGAGTGAAGGCTGTGAAGTCGTCAGAACACATCAACGAGGGGGAG
ACGGCCATGCTGGTCTGCAAGTCAGAGTCCGTGCCACCTGTCACTGACTGGGCCTGGTAC
AAGATCACTGACTCTGAGGACAAGGCCCTCATGAACGGCTCCGAGAGCAGGTTCTTCGTG
AGTTCCTCGCAGGGCCGGTCAGAGCTACACATTGAGAACCTGAACATGGAGGCCGACCCC
GGCCAGTACCGGTGCAACGGCACCAGCTCCAAGGGCTCCGACCAGGCCATCATCACGCTC
CGCGTGCGCAGCCACCTGGCCGCCCTCTGGCCCTTCCTGGGCATCGTGGCTGAGGTGCTG
GTGCTGGTCACCATCATCTTCATCTACGAGAAGCGCCGGAAGCCCGAGGACGTCCTGGAT
GATGACGACGCCGGCTCTGCACCCCTGAAGAGCAGCGGGCAGCACCAGAATGACAAAGGC
AAGAACGTCCGCCAGAGGAACTCTTCCTGA

Clone variation with respect to NM_198589.1
5' Read Nucleotide Sequence
>OriGene 5' read for NM_198589 unedited
GTATACGACTCACTAAGGGCGGCCGCGACTTCGGCACGAGGGGTTGTAGGACCGGCGAGT
GATAGGAATCATGGCGGCTGCGCTGTTCGTGCTGCTGGGATTCGCGCTGCTGGGCACCCA
CGGAGCCTCCGGGGCTGCCGGCACAGTCTTCACTACCGTAGAAAGACCTTGGCTCCAAGA
TACTCCTCACCTGCTCCTTGAATGACAGCGCCACAGAGGTCACAGGGCACCGCTGGCTGA
AGGGGGGCGTGGTGCTGAAGGAGGACGCGCTGCCCGGCCAGAAAACGGAGTTCAAGGTGG
ACTCCGACGACCAGTGGGGAGAGTACTCCTGCGTCTTCCTCCCCGAGCCCATGGGCACGG
CCAACATCCAGCTCCACGGGCCTCCCAGAGTGAAGGCTGTGAAGTCGTCAGAACACATCA
ACGAGGGGGAGACGGCCATGCTGGTCTGCAAGTCAGAGTCCGTGCCACCTGTCACTGACT
GGGCCTGGTACAAGATCACTGACTCTGAGGACAAGGCCCTCATGAACGGCTCCGAGAGCA
GGTTCTTCGTGAGTTCCTCGCAGGGCCGGTCAGAGCTACACATTGAGAACCTGAACATGG
AGGCCGACCCCGGCCAGTACCGGTGCAACGGCACCAGCTNCAGGGCTCCGACCAGGCCAT
CATCACGCTCCGCGTGCGCAGCCACCTGGCCGGCCTTCTGCCCTTTCTGGGCATCGTGGC
TGAAGTGCTGGTGCTGGNCACCATCATCTTCATCTACAAAAAGCGCGGGAGCCCGAGGAC
GTCCTGGAGATGACCAAGCCCGCTTTGGACCCTGAAAAGAACGGGCAGACCAGATGACAA
GGCANAACTCCGCAGAGAACTTTCTGGAGGGGCCGAGAACTTCCTGGTCCATTTGGCCCC
GCCGAAACCATCCAAGCTTC
Restriction Sites NotI-NotI |
ACCN NM_198589
Insert Size 1670 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_198589.1, NP_940991.1
RefSeq Size 1676 bp
RefSeq ORF 810 bp
Locus ID 682
UniProt ID P35613
Cytogenetics 19p13.3
Protein Families Druggable Genome, ES Cell Differentiation/IPS, Transmembrane
Summary The protein encoded by this gene, basigin, is a plasma membrane protein that is important in spermatogenesis, embryo implantation, neural network formation, and tumor progression. Basigin is also a member of the immunoglobulin superfamily, ubiquitously expressed in various tissues. Multiple transcript variants encoding different isoforms have been found for this gene. provided by RefSeq, May 2020
Transcript Variant: This variant (2) lacks an alternate in-frame exon compared to variant 1. The resulting isoform (2) has the same N- and C-termini but is shorter compared to isoform 1. Variants 2 and 5 both encode the same isoform (2).
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_198589" in other vectors (6)
SKU Description Size Price
RC203894 BSG (Myc-DDK-tagged)-Human basigin (Ok blood group) (BSG), transcript variant 2 10 ug
$300.00
RC203894L1 Lenti ORF clone of Human basigin (Ok blood group) (BSG), transcript variant 2, Myc-DDK-tagged 10 ug
$600.00
RC203894L2 Lenti ORF clone of Human basigin (Ok blood group) (BSG), transcript variant 2, mGFP tagged 10 ug
$600.00
RC203894L3 Lenti ORF clone of Human basigin (Ok blood group) (BSG), transcript variant 2, Myc-DDK-tagged 10 ug
$600.00
RC203894L4 Lenti ORF clone of Human basigin (Ok blood group) (BSG), transcript variant 2, mGFP tagged 10 ug
$600.00
RG203894 BSG (tGFP-tagged) - Human basigin (Ok blood group) (BSG), transcript variant 2 10 ug
$489.00 $500.00

file-alt Citations

Involvement of miR-485-5p in hepatocellular carcinoma progression targeting EMMPRIN
Sun, Liu, Li et al
Biomedicine & Pharmacotherapy (2015) 72, 58–65
AI Summary: OriGene's EMMPRIN plasmid was used in this study to investigate the role of EMMPRIN in hepatocellular carcinoma progression targeted by miR-485-5p.
Snippet: Anti-GAPDH antibody and secondary antibodies conjugated with HRP were purchased from Kang-Chen Biotech (Kangcheng, Shanghai, China). EMMPRIN plasmid was ordered from Origene (Rockville, MD, USA). 2.4. Plasmid vector construction and lentivirus ... Cite SaveSaving
Showing 1-1 of 1 papers.
Powered by BizGenius
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products