OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

UCN2 (NM_033199) Human Untagged Clone

Be the first to review this product
SKU
SC125278
UCN2 (untagged)-Human urocortin 2 (UCN2)
  $150.00
In Stock*
Bulk Requests & Clone Modifications

Frequently Bought Together (4)

TA383060 UCN2 Rabbit polyclonal Antibody
100 ul
$410.00
CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "UCN2 or NM_033199"

Specifications
Specifications
Product Data
Type Human Untagged Clone
Target Symbol UCN2
Synonyms SRP; UCN-II; UCNI; UR; URP
Vector pCMV6-XL4
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
Fully Sequenced ORF
>OriGene ORF within SC125278 sequence for NM_033199 edited (data generated by NextGen Sequencing)
ATGACCAGGTGTGCTCTGCTGTTGCTGATGGTCCTGATGTTGGGCAGAGTCCTGGTTGTC
CCAGTGACCCCTATCCCAACCTTCCAGCTCCGCCCTCAGAATTCTCCCCAGACCACTCCC
CGACCTGCGGCCTCAGAGAGCCCCTCAGCTGCTCCCACATGGCCGTGGGCTGCCCAGAGC
CACTGCAGCCCCACCCGCCACCCTGGCTCGCGCATTGTCCTATCGCTGGATGTCCCCATC
GGCCTCTTGCAGATCTTACTGGAGCAAGCCCGGGCCAGGGCTGCCAGGGAGCAGGCCACC
ACCAACGCCCGCATCCTGGCCCGTGTCGGCCACTGCTGA

Clone variation with respect to NM_033199.3
5' Read Nucleotide Sequence
>OriGene 5' read for NM_033199 unedited
CATTGTGTAATACGACTCACTATAGGGCGGCCGCGAATTCAGATCTGGTACCGGTCCGGA
ATTCCCGGGATATCGTCGACCCACGCGTCCGGTAGTGCCTGGCCCCAGCCCCAGGCAGCC
ACAGCAGGCTGCCTTACCCCAGAAGCAGCTGGTGGCGCCTGACCTCACGATGACCAGGTG
TGCTCTGCTGTTGCTGATGGTCCTGATGTTGGGCAGAGTCCTGGTTGTCCCAGTGACCCC
TATCCCAACCTTCCAGCTCCGCCCTCAGAATTCTCCCCAGACCACTCCCCGACCTGCNGG
CCTCAAGAGCCCCTCAGCTGTCCCACATGGCGTGGCTGCCAGAGCCACTGCAGCCCACCC
GCACCCTGCTCGCCATTGCCTATCGTGGTGTCCCCATCGCCTCTTGCAGATCTTACTGGA
GCAAGCCCGGGCCAGGGCTGCCAGGGAGCAGGGCCACCCACCAACGCCCGATCCTGCCCG
TGTCGCCACTGCTGAGCCTGAGAGAGGGGTCACAGTGATAGGGCACCCTGGATGGGAAGA
CCTTGAGGCCAACCACCCAGCTTGACGGATGCTGCACATCTGGGCATACAGTGTCTGGAC
CCTGCACATCTGGNCATACAGTGTCTGGACACTGCACATGGAACC
Restriction Sites Please inquire |
ACCN NM_033199
Insert Size 1500 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_033199.3, NP_149976.1
RefSeq Size 1546 bp
RefSeq ORF 339 bp
Locus ID 90226
UniProt ID Q96RP3
Cytogenetics 3p21.31
Protein Families Druggable Genome, Secreted Protein, Transmembrane
Summary This gene is a member of the sauvagine/corticotropin-releasing factor/urotensin I family. It is structurally related to the corticotropin-releasing factor (CRF) gene and the encoded product is an endogenous ligand for CRF type 2 receptors. In the brain it may be responsible for the effects of stress on appetite. In spite of the gene family name similarity, the product of this gene has no sequence similarity to urotensin II. provided by RefSeq, Jul 2008
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_033199" in other vectors (6)
SKU Description Size Price
RC201333 UCN2 (Myc-DDK-tagged)-Human urocortin 2 (UCN2) 10 ug
$150.00
RC201333L1 Lenti ORF clone of Human urocortin 2 (UCN2), Myc-DDK-tagged 10 ug
$450.00
RC201333L2 Lenti ORF clone of Human urocortin 2 (UCN2), mGFP tagged 10 ug
$450.00
RC201333L3 Lenti ORF clone of Human urocortin 2 (UCN2), Myc-DDK-tagged 10 ug
$450.00
RC201333L4 Lenti ORF clone of Human urocortin 2 (UCN2), mGFP tagged 10 ug
$450.00
RG201333 UCN2 (tGFP-tagged) - Human urocortin 2 (UCN2) 10 ug
$489.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products