OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

APOL3 (NM_145642) Human Untagged Clone

Be the first to review this product
SKU
SC124455
APOL3 (untagged)-Human apolipoprotein L, 3 (APOL3), transcript variant beta/b
  $300.00
In Stock*
Bulk Requests & Clone Modifications

Frequently Bought Together (4)

TA305719 Goat Anti-APOL3 Antibody
100 ug
$565.00
CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "APOL3 or NM_145642"

Specifications
Specifications
Product Data
Type Human Untagged Clone
Target Symbol APOL3
Synonyms apoL-III; APOLIII; CG12_1; CG121
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
Fully Sequenced ORF
>NCBI ORF sequence for NM_145642, the custom clone sequence may differ by one or more nucleotides


ATGTCCCTTGCTGGTCTTGTTTTGGCACCATTTACAGCAGGGACGAGTCTGGCCCTTACTGCAGCTGGGG
TAGGGCTGGGAGCAGCGTCTGCTGTGACTGGGATCACCACCAGCATCGTGGAGCACTCATACACATCATC
AGCAGAAGCTGAAGCCAGCAGGCTGACTGCAACCAGCATTGACCGATTGAAGGTATTTAAGGAAGTTATG
CGTGACATCACACCCAACTTACTTTCCCTTCTTAATAATTATTACGAAGCCACACAAACCATTGGGAGTG
AAATCCGTGCCATCAGGCAAGCCAGAGCCAGGGCCCGACTCCCTGTGACCACCTGGCGAATCTCAGCTGG
AAGTGGTGGTCAAGCAGAGAGAACGATTGCAGGCACCACCCGGGCAGTGAGCAGAGGAGCCCGGATCCTG
AGTGCGACCACTTCAGGCATCTTCCTTGCACTGGATGTGGTCAACCTTGTATACGAGTCAAAGCACTTGC
ATGAGGGGGCAAAGTCTGCATCTGCTGAGGAGCTGAGGCGGCAGGCTCAGGAGCTGGAGGAGAATCTAAT
GGAGCTCACTCAGATCTATCAGCGTCTGAATCCATGCCATACCCACTGA

5' Read Nucleotide Sequence
>OriGene 5' read for NM_145642 unedited
ATACGACTCACTATAGGGCGGCCGCGAATTCGGCACGAGGGTGGGATCCACACAGCTCAG
AACAGCTGGATCTTGCTCACACTCTTTCAAGAGAAGCTTCCTTGGGTTAAGAAAAAAAAC
GAACCCTTCCAGTCAGGTCAGTGACTGGAGAGCTCCAAGGAAAGTCTCTCAGTGACCTGG
CTGCTGGCACCATGGACTCAGAAAAGAAACGCTTTACTGAAGAGGCCACCAAATACTTCC
GGGAGAGAGTCAGCCCAGTGCATCTGCAAATCCTGCTGACTAACAATGAAGCCTGGAAGA
GATTCGTGACTGCGGCTGAATTGCCCAGGGATGAGGCAGATGCTCTCTACGAAGCTCTGA
AGAAGCTTAGAACATATGCAGCTATTGAGGACGAATATGTGCAGCAGAAAGATGAGCAGT
TTAGGGAATGGTTTTTGAAAGAGTTTCCCCAAGTCAAGAGGAAGATCCAGGAGTCCATAG
AAAAGCTTCGTGCCCTTGCAAATGGTATTGAAGAGGTCCACAGAGGCTGCACCATCTCCA
ACGTGGTGTCCAGCTCCACTGGCGCTGCCTCTGGCATCATGTCCCTTGCTGGTCTTGTNT
GGCACCATNTACAGCAGGNACGAGTCTGGCCCTTACTGCNAGCTGGGTAGGGCTGGGAGC
ANCGTCTGCTGTGACTGGGATCACANCAGCATCGTGGAGCACTCATACACATCATCAGCA
GAAGCTGAAGCCCAGCAGCTGACTGCAACCAGCATTGACCGNATGAGGTATNTTAAGAAA
GTATGCGTGACACACACCCAACTACTTNCCTTNNCTATATTATACGAACCCCCAAACATG
GGAGTGAATCGTGCCATAGCAGCCAGACCGGCCNACTCCTGGACACCTGCGATCTACTGG
AGTGTGGCAGCN
Restriction Sites NotI-NotI |
ACCN NM_145642
Insert Size 2100 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_145642.1, NP_663617.1
RefSeq Size 3564 bp
RefSeq ORF 609 bp
Locus ID 80833
UniProt ID O95236
Cytogenetics 22q12.3
Summary This gene is a member of the apolipoprotein L gene family, and it is present in a cluster with other family members on chromosome 22. The encoded protein is found in the cytoplasm, where it may affect the movement of lipids, including cholesterol, and/or allow the binding of lipids to organelles. In addition, expression of this gene is up-regulated by tumor necrosis factor-alpha in endothelial cells lining the normal and atherosclerotic iliac artery and aorta. Alternative splicing results in multiple transcript variants. provided by RefSeq, Mar 2015
Transcript Variant: This variant (beta/b) differs in the 5' UTR, lacks a portion of the 5' coding region, and uses a downstream translational start codon, compared to variant alpha/d. The encoded isoform (3) is shorter at the N-terminus, compared to isoform 1. Both variants beta/a and beta/b encode the same isoform.
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_145642" in other vectors (6)
SKU Description Size Price
RC215191 APOL3 (Myc-DDK-tagged)-Human apolipoprotein L, 3 (APOL3), transcript variant beta/b 10 ug
$300.00
RC215191L1 Lenti ORF clone of Human apolipoprotein L, 3 (APOL3), transcript variant beta/b, Myc-DDK-tagged 10 ug
$600.00
RC215191L2 Lenti ORF clone of Human apolipoprotein L, 3 (APOL3), transcript variant beta/b, mGFP tagged 10 ug
$600.00
RC215191L3 Lenti ORF clone of Human apolipoprotein L, 3 (APOL3), transcript variant beta/b, Myc-DDK-tagged 10 ug
$600.00
RC215191L4 Lenti ORF clone of Human apolipoprotein L, 3 (APOL3), transcript variant beta/b, mGFP tagged 10 ug
$600.00
RG215191 APOL3 (tGFP-tagged) - Human apolipoprotein L, 3 (APOL3), transcript variant beta/b 10 ug
$500.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products