OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

GPBAR1 (NM_170699) Human Untagged Clone

Be the first to review this product
SKU
SC123312
GPBAR1 (untagged)-Human G protein-coupled bile acid receptor 1 (GPBAR1), transcript variant 3
  $300.00
In Stock*
Bulk Requests & Clone Modifications

Frequently Bought Together (4)

TA336959 Rabbit Polyclonal TGR5/GPBAR1 Antibody
100 ul
$730.00
CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "GPBAR1 or NM_170699"

Specifications
Specifications
Product Data
Type Human Untagged Clone
Target Symbol GPBAR1
Synonyms BG37; GPCR19; GPR131; M-BAR; TGR5
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
Fully Sequenced ORF
>OriGene sequence for NM_001077194 edited
GCAGAGCCTGGGTAGGAGAGCCTGGCCCCGCTGTCCCCACTGGGTGGAGACACCATGCAC
TTGGTCCTTGTGCTCTTCAGCCAGGACACCAGACATGGTCCAAACCGCTGCAGGGCTGGC
TGCAGCAACTCCCTGACACTCAGGAAGGCCCAGGCTGGGCAGGCAATACCTGCTCCCAAC
AGCCATGCATGCCGGCTGCCGCTCCAGGACTCCCCTGTCCCCAGGACCAAGATGACGCCC
AACAGCACTGGCGAGGTGCCCAGCCCCATTCCCAAGGGGGCTTTGGGGCTCTCCCTGGCC
CTGGCAAGCCTCATCATCACCGCGAACCTGCTCCTAGCCCTGGGCATCGCCTGGGACCGC
CGCCTGCGCAGCCCACCTGCTGGCTGCTTCTTCCTGAGCCTACTGCTGGCTGGGCTGCTC
ACGGGTCTGGCATTGCCCACATTGCCAGGGCTGTGGAACCAGAGTCGCCGGGGTTACTGG
TCCTGCCTCCTCGTCTACTTGGCTCCCAACTTCTCCTTCCTCTCCCTGCTTGCCAACCTC
TTGCTGGTGCACGGGGAGCGCTACATGGCAGTCCTGAGGCCACTCCAGCCCCCTGGGAGC
ATTCGGCTGGCCCTGCTCCTCACCTGGGCTGGTCCCCTGCTCTTTGCCAGTCTGCCCGCT
CTGGGGTGGAACCACTGGACCCCTGGTGCCAACTGCAGCTCCCAGGCTATCTTCCCAGCC
CCCTACCTGTACCTCGAAGTCTATGGGCTCCTGCTGCCCGCCGTGGGTGCTGCTGCCTTC
CTCTCTGTCCGCGTGCTGGCCACTGCCCACCGCCAGCTGCAGGACATCTGCCGGCTGGAG
CGGGCAGTGTGCCGCGATGAGCCCTCCGCCCTGGCCCGGGCCCTTACCTGGAGGCAGGCA
AGGGCACAGGCTGGAGCCATGCTGCTCTTCGGGCTGTGCTGGGGGCCCTACGTGGCCACA
CTGCTCCTCTCAGTCCTGGCCTATGAGCAGCGCCCGCCACTGGGGCCTGGGACACTGTTG
TCCCTCCTCTCCCTAGGAAGTGCCAGTGCAGCGGCAGTGCCCGTAGCCATGGGGCTGGGC
GATCAGCGCTACACAGCCCCCTGGAGGGCAGCCGCCCAAAGGTGCCTGCAGGGGCTGTGG
GGAAGAGCCTCCCGGGACAGTCCCGGCCCCAGCATTGCCTACCACCCAAGCAGCCAAAGC
AGTGTCGACCTGGACTTGAACTAAAGGAAGGGCCTCTGCTGACTCCTACCAGAGCATCCG
TCCAGCTCAGCCATCCAGCCTGTCTCTACTGGGCCCCACTTCTCTGGATCAGAGACCCTG
CCTCTGTTTGACCCCGCACTGACTGAATAAAGCTCCTCTGGCCGTTAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAA
5' Read Nucleotide Sequence
>OriGene 5' read for NM_170699 unedited
TATAGGGCGGCCGAGACTTCCCGGGNTGCAGAGCCTGGTTAGGAGAGCCTGGCCCCGCTG
TCCCCCTGGGTGGAGACACCATGCACTTGGTCCTTGTGCTCTTCAGCCAGGACACCAGAC
ATGGTCCAAACCGCTGCAGGGCTGGCTGCAGCAACTCCCTGACACTCAGGAAGGCCCAGG
CTGGGCTGTTTATACCTGCTCCCAACAGCCATGCATGCCGGCTGCCGCTCCAGGACTCCC
CTGTCCCCAGGACCAAGATGACGCCCAACAGCACTGGCGAGGTGCCCAGCCCCATTCCCA
AGGGGGCTTTGGGGCTCTCCCTGGCCCTGGCAAGCCTCATCATCACCGCGAACCTGCTCC
TAGCCCTGGGCATCGCCTGGGACCGCCGCCTGCGCAGCCCACCTGCTGGCTGCTTCTTCC
TGAGCCTACTGCTGGCTGGGCTGCTCACGGGTCTGGCATTGCCCACATTGCCAGGGCTGT
GGAACCAGAGTCGCCGGGGTTACTGGTCCTGCCTCCTCGTCTACTTGGCTCCCAACTTCT
CCTTCCTCTCCCTGCTTGCCAACCTCTTGCTGGTGCACGGNGAGCGCTACATGGCAGTCC
TGAGGCCACTCCAGCCCCCTGGGAGCATTCGGCTGGCCCTGCTCCTCACCTGGGCTGGTC
CCCTGCTCTTTGCCAGTCTGCCCGCTCTGGGGTGGAACCACTGGACCCCTGGTGCAACTG
CAGCTCCCAGCTATCTTCCCAGCCCCCTACCTGTACCTCGAAGTCTATGGGCTCCTGCTG
CCCGCCGTGGGTGCTGCTGCCTTCCTCTCTGTCCGCGTGCTGGCCACTGCCCACCGCCAG
CTGCAGGACATCTGCCGGCTGGAGCGGGCAGTGTGCCGCGN
Restriction Sites Please inquire |
ACCN NM_170699
Insert Size 1400 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_170699.1, NP_733800.1
RefSeq Size 1400 bp
RefSeq ORF 993 bp
Locus ID 151306
UniProt ID Q8TDU6
Cytogenetics 2q35
Protein Families Druggable Genome
Summary This gene encodes a member of the G protein-coupled receptor (GPCR) superfamily. This enzyme functions as a cell surface receptor for bile acids. Treatment of cells expressing this GPCR with bile acids induces the production of intracellular cAMP, activation of a MAP kinase signaling pathway, and internalization of the receptor. The receptor is implicated in the suppression of macrophage functions and regulation of energy homeostasis by bile acids. Alternative splicing results in multiple transcript variants encoding the same protein. provided by RefSeq, Jul 2008
Transcript Variant: This variant (3) differs in the 5' UTR compared to variant 1. Variants 1, 2, and 3 encode the same protein.
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_170699" in other vectors (6)
SKU Description Size Price
RC221897 GPBAR1 (Myc-DDK-tagged)-Human G protein-coupled bile acid receptor 1 (GPBAR1), transcript variant 3 10 ug
$300.00
RC221897L1 Lenti ORF clone of Human G protein-coupled bile acid receptor 1 (GPBAR1), transcript variant 3, Myc-DDK-tagged 10 ug
$600.00
RC221897L2 Lenti ORF clone of Human G protein-coupled bile acid receptor 1 (GPBAR1), transcript variant 3, mGFP tagged 10 ug
$600.00
RC221897L3 Lenti ORF clone of Human G protein-coupled bile acid receptor 1 (GPBAR1), transcript variant 3, Myc-DDK-tagged 10 ug
$600.00
RC221897L4 Lenti ORF clone of Human G protein-coupled bile acid receptor 1 (GPBAR1), transcript variant 3, mGFP tagged 10 ug
$600.00
RG221897 GPBAR1 (tGFP-tagged) - Human G protein-coupled bile acid receptor 1 (GPBAR1), transcript variant 3 10 ug
$489.00 $500.00

file-alt Citations

Discovery and characterization of small-molecule TGR5 ligands with agonistic activity
Papadopoulos, Perhal, Medel-Lacruz et al
European Journal of Medicinal Chemistry (2024)
Cited by 8
AI Summary: OriGene’s GPBAR1 transcript variant 3 (NM_170699) Human Untagged cDNA Clone (SC123312) was used as the source of TGR5 cDNA for expression studies in this research.
Snippet: GPBAR1 transcript variant 3 (NM_170699) Human Untagged cDNA Clone (SC123312) was obtained from OriGene Technologies GmbH (Herford, Germany) and subcloned into the pcDNA3.1/Zeo(+) mammalian expression vector (Thermo Fisher Scientific) using the restriction sites NotI/NotI (New England
Bile acids are important direct and indirect regulators of the secretion of appetite- and metabolism-regulating hormones from the gut and pancreas
Kuhre, Wewer Albrechtsen, Larsen et al
Mol Metab (2018) 11, 84-95 DOI: 10.1016/j.molmet.2018.03.007
Cited by 229
AI Summary: In this study, OriGene products, specifically the TGR5 knockout (KO) mouse model, were used to demonstrate that bile acids stimulate secretion of appetite- and metabolism-regulating hormones via activation of TGR5 receptors on intestinal L-cells.
FigureFigureFigure
Bile acids are important direct and indirect regulators of the secretion of appetite- and metabolism-regulating hormones from the gut and pancreas
Kuhre, Wewer Albrechtsen, Larsen et al
Molecular Metabolism (2018)
AI Summary: OriGene products pCMV6-XL5 (Cat. no. SC123312) and pCMV6-Entry (Cat. no. RN210451) plasmid vectors were used for transient transfection to study hormone secretion mechanisms in this research.
Snippet: …SC123312 and RN210451, OriGene, Technologies Inc., Rockville, MD). …SC123312 and RN210451, OriGene, Technologies Inc., Rockville, MD). …
Allspice and Clove As Source of Triterpene Acids Activating the G Protein-Coupled Bile Acid Receptor TGR5
Ladurner, Zehl, Grienke et al
Front Pharmacol (2017) 8, 468 DOI: 10.3389/fphar.2017.00468
Cited by 37
AI Summary: In this study, OriGene's human TGR5 expression plasmid (RC221527) and human TGR5 shRNA plasmid (TF320442) were used to investigate the activation of the TGR5 receptor by plant extracts, helping to elucidate the role of triterpene acids from clove and allspice in TGR5-mediated metabolic effects.
FigureFigureFigure
Spergularia marina Induces Glucagon-Like Peptide-1 Secretion in NCI-H716 Cells Through Bile Acid Receptor Activation
Kim, Lee, Rhyu et al
J Med Food (2014)
Cited by 10
AI Summary: OriGene’s human TGR5 cDNA cloned in the pCMV6-XL5 expression vector was used to transiently transfect CHO-K1 cells, enabling the study of TGR5 agonist activity in the investigation of Spergularia marina's effects on GLP-1 secretion.
Snippet: TGR5 transfection in CHO-K1 cells Human TGR5 cDNA cloned to the pCMV6-XL5 expression vector was purchased from Origene Technologies, Inc. (Rockville, MD, USA) and amplified in chemically component cells by the heat shock method. ... Cite SaveSaving
Ginsenoside metabolite compound K stimulates glucagon-like peptide-1 secretion in NCI-H716 cells via bile acid receptor activation
Kim, Park, Lee et al
Arch. Pharm. Res. (2014)
Cited by 53
AI Summary: OriGene's human TGR5 cDNA cloned in the pCMV6-XL5 expression vector was used to transiently transfect CHO-K1 cells, enabling the authors to assess TGR5 agonist activity of compound K in their study.
Snippet: TGR5 transfection in CHO-K1 cells. Human TGR5 cDNA cloned to pCMV6-XL5 expression vector was from Origene Technologies, Inc., (Rockville, MD, USA), and amplified in chemically component cells by heat shock method. ... Cite SaveSaving
Showing 1-6 of 6 papers.
Powered by BizGenius
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products