OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

Rel B (RELB) (NM_006509) Human Untagged Clone

Be the first to review this product
SKU
SC122747
RELB (untagged)-Human v-rel reticuloendotheliosis viral oncogene homolog B (RELB)
  $540.00
In Stock*
Bulk Requests & Clone Modifications

Frequently Bought Together (3)

CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "Rel B or NM_006509"

Specifications
Specifications
Product Data
Type Human Untagged Clone
Target Symbol Rel B
Synonyms I-REL; IMD53; IREL; REL-B
Vector PCMV6-Neo
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>NCBI ORF sequence for NM_006509, the custom clone sequence may differ by one or more nucleotides


ATGCTTCGGTCTGGGCCAGCCTCTGGGCCGTCCGTCCCCACTGGCCGGGCCATGCCGAGTCGCCGCGTCG
CCAGACCGCCGGCTGCGCCGGAGCTGGGGGCCTTAGGGTCCCCCGACCTCTCCTCACTCTCGCTCGCCGT
TTCCAGGAGCACAGATGAATTGGAGATCATCGACGAGTACATCAAGGAGAACGGCTTCGGCCTGGACGGG
GGACAGCCGGGCCCGGGCGAGGGGCTGCCACGCCTGGTGTCTCGCGGGGCTGCGTCCCTGAGCACGGTCA
CCCTGGGCCCTGTGGCGCCCCCAGCCACGCCGCCGCCTTGGGGCTGCCCCCTGGGCCGACTAGTGTCCCC
AGCGCCGGGCCCGGGCCCGCAGCCGCACCTGGTCATCACGGAGCAGCCCAAGCAGCGCGGCATGCGCTTC
CGCTACGAGTGCGAGGGCCGCTCGGCCGGCAGCATCCTTGGGGAGAGCAGCACCGAGGCCAGCAAGACGC
TGCCCGCCATCGAGCTCCGGGATTGTGGAGGGCTGCGGGAGGTGGAGGTGACTGCCTGCCTGGTGTGGAA
GGACTGGCCTCACCGAGTCCACCCCCACAGCCTCGTGGGGAAAGACTGCACCGACGGCATCTGCAGGGTG
CGGCTCCGGCCTCACGTCAGCCCCCGGCACAGTTTTAACAACCTGGGCATCCAGTGTGTGAGGAAGAAGG
AGATTGAGGCTGCCATTGAGCGGAAGATTCAACTGGGCATTGACCCCTACAACGCTGGGTCCCTGAAGAA
CCATCAGGAAGTAGACATGAATGTGGTGAGGATCTGCTTCCAGGCCTCATATCGGGACCAGCAGGGACAG
ATGCGCCGGATGGATCCTGTGCTTTCCGAGCCCGTCTATGACAAGAAATCCACAAACACATCAGAGCTGC
GGATTTGCCGAATTAACAAGGAAAGCGGGCCGTGCACCGGTGGCGAGGAGCTCTACTTGCTCTGCGACAA
GGTGCAGAAAGAGGACATATCAGTGGTGTTCAGCAGGGCCTCCTGGGAAGGTCGGGCTGACTTCTCCCAG
GCCGACGTGCACCGCCAGATTGCCATTGTGTTCAAGACGCCGCCCTACGAGGACCTGGAGATTGTCGAGC
CCGTGACAGTCAACGTCTTCCTGCAGCGGCTCACCGATGGGGTCTGCAGCGAGCCATTGCCTTTCACGTA
CCTGCCTCGCGACCATGACAGCTACGGCGTGGACAAGAAGCGGAAACGGGGGATGCCCGACGTCCTTGGG
GAGCTGAACAGCTCTGACCCCCATGGCATCGAGAGCAAACGGCGGAAGAAAAAGCCGGCCATCCTGGACC
ACTTCCTGCCCAACCACGGCTCAGGCCCGTTCCTCCCGCCGTCAGCCCTGCTGCCAGACCCTGACTTCTT
CTCTGGCACCGTGTCCCTGCCCGGCCTGGAGCCCCCTGGCGGGCCTGACCTCCTGGACGATGGCTTTGCC
TACGACCCTACGGCCCCCACACTCTTCACCATGCTGGACCTGCTGCCCCCGGCACCGCCACACGCTAGCG
CTGTTGTGTGCAGCGGAGGTGCCGGGGCCGTGGTTGGGGAGACCCCCGGCCCTGAACCACTGACACTGGA
CTCGTACCAGGCCCCGGGCCCCGGGGATGGAGGCACCGCCAGCCTTGTGGGCAGCAACATGTTCCCCAAT
CATTACCGCGAGGCGGCCTTTGGGGGCGGCCTCCTATCCCCGGGGCCTGAAGCCACGTAG
Restriction Sites Please inquire |
ACCN NM_006509
Insert Size 2248 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_006509.2, NP_006500.2
RefSeq Size 2287 bp
RefSeq ORF 1740 bp
Locus ID 5971
UniProt ID Q01201
Cytogenetics 19q13.32
Protein Families Druggable Genome, Transcription Factors
Protein Pathways MAPK signaling pathway
Summary NF-kappa-B is a pleiotropic transcription factor which is present in almost all cell types and is involved in many biological processed such as inflammation, immunity, differentiation, cell growth, tumorigenesis and apoptosis. NF-kappa-B is a homo- or heterodimeric complex formed by the Rel-like domain-containing proteins RELA/p65, RELB, NFKB1/p105, NFKB1/p50, REL and NFKB2/p52. The dimers bind at kappa-B sites in the DNA of their target genes and the individual dimers have distinct preferences for different kappa-B sites that they can bind with distinguishable affinity and specificity. Different dimer combinations act as transcriptional activators or repressors, respectively. NF-kappa-B is controlled by various mechanisms of post-translational modification and subcellular compartmentalization as well as by interactions with other cofactors or corepressors. NF-kappa-B complexes are held in the cytoplasm in an inactive state complexed with members of the NF-kappa-B inhibitor (I-kappa-B) family. In a conventional activation pathway, I-kappa-B is phosphorylated by I-kappa-B kinases (IKKs) in response to different activators, subsequently degraded thus liberating the active NF-kappa-B complex which translocates to the nucleus. NF-kappa-B heterodimeric RelB-p50 and RelB-p52 complexes are transcriptional activators. RELB neither associates with DNA nor with RELA/p65 or REL. Stimulates promoter activity in the presence of NFKB2/p49. As a member of the NUPR1/RELB/IER3 survival pathway, may provide pancreatic ductal adenocarcinoma with remarkable resistance to cell stress, such as starvation or gemcitabine treatment. Regulates the circadian clock by repressing the transcriptional activator activity of the CLOCK-ARNTL/BMAL1 heterodimer in a CRY1/CRY2 independent manner. Increased repression of the heterodimer is seen in the presence of NFKB2/p52. Is required for both T and B lymphocyte maturation and function (PubMed:26385063).UniProtKB/Swiss-Prot Function
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_006509" in other vectors (6)
SKU Description Size Price
RC207006 RELB (Myc-DDK-tagged)-Human v-rel reticuloendotheliosis viral oncogene homolog B (RELB) 10 ug
$539.00
RC207006L1 Lenti ORF clone of Human v-rel reticuloendotheliosis viral oncogene homolog B (RELB), Myc-DDK-tagged 10 ug
$839.00
RC207006L2 Lenti ORF clone of Human v-rel reticuloendotheliosis viral oncogene homolog B (RELB), mGFP tagged 10 ug
$839.00
RC207006L3 Lenti ORF clone of Human v-rel reticuloendotheliosis viral oncogene homolog B (RELB), Myc-DDK-tagged 10 ug
$839.00
RC207006L4 Lenti ORF clone of Human v-rel reticuloendotheliosis viral oncogene homolog B (RELB), mGFP tagged 10 ug
$839.00
RG207006 RELB (tGFP-tagged) - Human v-rel reticuloendotheliosis viral oncogene homolog B (RELB) 10 ug
$489.00 $739.00

file-alt Citations

Functional genetic screen identifies ITPR3/calcium/RELB axis as a driver of colorectal cancer metastatic liver colonization
Moy, Nguyen, Loo et al
Dev Cell (2022) 57 (9), 1146-1159.e7 DOI: 10.1016/j.devcel.2022.04.010
Cited by 24
AI Summary: OriGene products pCMV6-Entry (Cat# PS100001) and pCMV6-RELB (Cat# SC122747) were used in this study to express and investigate the role of RELB in colorectal cancer metastatic liver colonization.
Snippet: Metastatic colonization is the primary cause of death from colorectal cancer (CRC). We employed genome-scale in vivo short hairpin RNA (shRNA) screening and Save;pRSV-Rev Cell Biolabs Cat# VPK-206 pSpCas(BB)-2A-Puro (PX459) V2.0 Addgene Cat# 62988;RRID: Addgene_62988 lentiCRISPR V2.0 Addgene Cat# 59261;RRID: Addgene_52961 pCMV6-Entry Origene Cat# PS100001 pCMV6-RELB Origene Cat# SC122747
Showing 1-1 of 1 papers.
Powered by BizGenius
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products