OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

FXYD2 (NM_001680) Human Untagged Clone

Be the first to review this product
SKU
SC121946
FXYD2 (untagged)-Human FXYD domain containing ion transport regulator 2 (FXYD2), transcript variant a
  $150.00
In Stock*
Bulk Requests & Clone Modifications

Frequently Bought Together (3)

CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "FXYD2 or NM_001680"

Specifications
Specifications
Product Data
Type Human Untagged Clone
Target Symbol FXYD2
Synonyms ATP1G1; HOMG2
Vector pCMV6-XL4
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
Fully Sequenced ORF
>OriGene ORF within SC121946 sequence for NM_001680 edited (data generated by NextGen Sequencing)
ATGACTGGGTTGTCGATGGACGGTGGCGGCAGCCCCAAGGGGGACGTGGACCCGTTCTAC
TATGACTATGAGACCGTTCGCAATGGGGGCCTGATCTTCGCTGGACTGGCCTTCATCGTG
GGGCTCCTCATCCTCCTCAGCAGAAGATTCCGCTGTGGGGGCAATAAGAAGCGCAGGCAA
ATCAATGAAGATGAGCCGTAA

Clone variation with respect to NM_001680.4
5' Read Nucleotide Sequence
>OriGene 5' read for NM_001680 unedited
GCACGAGGAAGAGGGGAGTGGAGGCAGCCCATTCACCTGGGGAAATGACTGGGTTGTCGA
TGGACGGTGGCGGCAGCCCCAAGGGGGACGTGGACCCGTTCTACTATGACTATGAGACCG
TTCGCAATGGGGGCCTGATCTTCGCTGGACTGGCCTTCATCGTGGGGCTCCTCATCCTCC
TCAGCAGAAGATTCCNCGGTGGGGGCAATAAGAAGCGCAGGCAAATCAATGAAGATGAGC
CGTAACAGCAGCCTCGGCGGTGCCACCCACTGCACTGGGGCCAGCTGGGAAGCCAAGCAT
GGCCCTGCCTCTGGCGCCTCCCCTTCTTCCCTGGGCTTTAGACCTTTGTCCCCGTCACTG
CCAGCGCTTGGGCTGAAGGAAGCTCCAGACTCAATGTGACCCCCAGGTGGCATCGCCAAC
TCCTGCCTCGTGCCACCTCATGCTTATAATAAAGCCGGCGTCAGAGACCGCTGCTTCCCT
CN
Restriction Sites NotI-NotI |
ACCN NM_001680
Insert Size 650 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001680.3, NP_001671.2
RefSeq Size 546 bp
RefSeq ORF 201 bp
Locus ID 486
UniProt ID P54710
Cytogenetics 11q23.3
Domains ATP1G1_PLM_MAT8
Protein Families Druggable Genome, Ion Channels: Other, Transmembrane
Summary This gene encodes a member of the FXYD family of transmembrane proteins. This particular protein encodes the sodium/potassium-transporting ATPase subunit gamma. Mutations in this gene have been associated with Renal Hypomagnesemia-2. Alternatively spliced transcript variants have been described. Read-through transcripts have been observed between this locus and the upstream FXYD domain-containing ion transport regulator 6 (FXYD6, GeneID 53826) locus.provided by RefSeq, Feb 2011
Transcript Variant: This variant (a) represents the most predominant transcript and encodes isoform 1.
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_001680" in other vectors (6)
SKU Description Size Price
RC205076 FXYD2 (Myc-DDK-tagged)-Human FXYD domain containing ion transport regulator 2 (FXYD2), transcript variant a 10 ug
$289.00
RC205076L1 Lenti ORF clone of Human FXYD domain containing ion transport regulator 2 (FXYD2), transcript variant a, Myc-DDK-tagged 10 ug
$450.00
RC205076L2 Lenti ORF clone of Human FXYD domain containing ion transport regulator 2 (FXYD2), transcript variant a, mGFP tagged 10 ug
$450.00
RC205076L3 Lenti ORF clone of Human FXYD domain containing ion transport regulator 2 (FXYD2), transcript variant a, Myc-DDK-tagged 10 ug
$450.00
RC205076L4 Lenti ORF clone of Human FXYD domain containing ion transport regulator 2 (FXYD2), transcript variant a, mGFP tagged 10 ug
$450.00
RG205076 FXYD2 (tGFP-tagged) - Human FXYD domain containing ion transport regulator 2 (FXYD2), transcript variant a 10 ug
$489.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products