OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

CCDC23 (SVBP) (NM_199342) Human Untagged Clone

Be the first to review this product
SKU
SC121611
CCDC23 (untagged)-Human coiled-coil domain containing 23 (CCDC23)
  $150.00
4 Weeks*
Bulk Requests & Clone Modifications

Frequently Bought Together (3)

CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "CCDC23 or NM_199342"

Specifications
Specifications
Product Data
Type Human Untagged Clone
Target Symbol CCDC23
Synonyms CCDC23; NEDAHM
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
Fully Sequenced ORF
>NCBI ORF sequence for NM_199342, the custom clone sequence may differ by one or more nucleotides


ATGGATCCACCTGCACGTAAAGAAAAAACCAAAGTTAAAGAATCTGTCAGCAGAGTTGAGAAGGCCAAAC
AGAAATCAGCCCAGCAGGAGCTGAAGCAGAGACAAAGAGCAGAGATCTATGCCCTCAACAGAGTCATGAC
AGAACTGGAGCAGCAGCAGTTTGATGAGTTCTGTAAACAGATGCAGCCTCCTGGAGAATGA

5' Read Nucleotide Sequence
>OriGene 5' read for NM_199342 unedited
AATACGACTCACTATAGGGCGGCCGCGAATTCGCCGAGGTGGTCGGGGGAAGGCGAGGAT
TACCCTCCCGGAGGCGTTGTCTGCGACTCGGCGGAGGCTCCAACTTCCAGTGGCCCGGTC
GGGAAAGATCAGAGCCTCCTAAGAAATATCCAGAAGTCAAGCCATGGATCCACCTGCACG
TAAAGAAAAAACCAAAGTTAAAGAATCTGTCAGCAGAGTTGAGAAGGCCAAACAGAAATC
AGCCCAGCAGGAGCTGAAGCAGAGACAAAGAGCAGAGATCTATGCCCTCAACAGAGTCAT
GACAGAACTGGAGCAGCAGCAGTTTGATGAGTTCTGTAAACAGATGCAGCCTCCTGGAGA
ATGAGGCCCCAGGTTCAAACCAGATGGGATCCTGAGAGCTTTGAGAGGGTGTTGCCAGTT
TTAAGCTGAGATGGCCCATTTGGAGCCTTACAGAACTAGACCAGAAGACATTTGTGGATA
AATCTGAACTCACTTCCTGTGTGTAACTTCTAACTTCACTGGTTCCTCCCATCTGAATTG
GCCACATGCTTGCTGAAGAGACTTGTTTTCTTCTTCTAAGACAGTGGTTTTGTTNTTTGG
GTTTTTAAAANAAAAAAAAAAAAAAACACACACAAAAAACACTTTTTCTATTGTTTGAGA
AAAATCAGTGTTTCTCATGAAACTCTATATCTTCTCCAAAAATCCAAATANATACTAATA
AAATGTTAAAAAAAAAANNNNNNNANNNNNNNNCNNNNANNNNNNNANNNNNNNNNNNNN
ANNNNNNNANNNNNNNNNAAAAAAAAAAAAAAAAAAAAAAAAAACCCCGGAAATTTTTTT
TTTTCCCCCCTGGATTTCAAGGGGGAGAAAAAAGGAACTCCCTCTAAAAAAAATAAAAAA
AAAAAAAAAAAGGGGGGGGCGA
Restriction Sites NotI-NotI |
ACCN NM_199342
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_199342.1, NP_955374.1
RefSeq Size 684 bp
RefSeq ORF 201 bp
Locus ID 374969
UniProt ID Q8N300
Cytogenetics 1p34.2
Summary Enhances the tyrosine carboxypeptidase activity of VASH1 and VASH2, thereby promoting the removal of the C-terminal tyrosine residue of alpha-tubulin (PubMed:29146869). Also required to enhance the solubility and secretion of VASH1 and VASH2 (PubMed:20736312, PubMed:27879017).UniProtKB/Swiss-Prot Function
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_199342" in other vectors (6)
SKU Description Size Price
RC205925 CCDC23 (Myc-DDK-tagged)-Human coiled-coil domain containing 23 (CCDC23) 10 ug
$150.00
RC205925L1 Lenti ORF clone of Human coiled-coil domain containing 23 (CCDC23), Myc-DDK-tagged 10 ug
$450.00
RC205925L2 Lenti ORF clone of Human coiled-coil domain containing 23 (CCDC23), mGFP tagged 10 ug
$450.00
RC205925L3 Lenti ORF clone of Human coiled-coil domain containing 23 (CCDC23), Myc-DDK-tagged 10 ug
$450.00
RC205925L4 Lenti ORF clone of Human coiled-coil domain containing 23 (CCDC23), mGFP tagged 10 ug
$450.00
RG205925 CCDC23 (tGFP-tagged) - Human coiled-coil domain containing 23 (CCDC23) 10 ug
$489.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products