alpha Synuclein (SNCA) (NM_000345) Human Untagged Clone
SKU
SC119919
SNCA (untagged)-Human synuclein, alpha (non A4 component of amyloid precursor) (SNCA), transcript variant 1
$150.00
In Stock*
Specifications
| Product Data | |
| Type | Human Untagged Clone |
|---|---|
| Target Symbol | alpha Synuclein |
| Synonyms | NACP; PARK1; PARK4; PD1 |
| Vector | pCMV6-XL5 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data | |
| Restriction Sites | NotI-NotI | |
| ACCN | NM_000345 |
| Insert Size | 423 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution Method | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Shipping | Ambient |
| Reference Data | |
| RefSeq | NM_000345.2, NP_000336.1 |
| RefSeq Size | 1543 bp |
| RefSeq ORF | 423 bp |
| Locus ID | 6622 |
| UniProt ID | P37840 |
| Cytogenetics | 4q22.1 |
| Domains | Synuclein |
| Protein Families | Druggable Genome |
| Protein Pathways | Alzheimer's disease, Parkinson's disease |
| Summary | Alpha-synuclein is a member of the synuclein family, which also includes beta- and gamma-synuclein. Synucleins are abundantly expressed in the brain and alpha- and beta-synuclein inhibit phospholipase D2 selectively. SNCA may serve to integrate presynaptic signaling and membrane trafficking. Defects in SNCA have been implicated in the pathogenesis of Parkinson disease. SNCA peptides are a major component of amyloid plaques in the brains of patients with Alzheimer's disease. Alternatively spliced transcripts encoding different isoforms have been identified for this gene. provided by RefSeq, Feb 2016 Transcript Variant: This variant (1, also known as NACP140) is the longest transcript and encodes the longer isoform (NACP140). Variants 1, 2, and 3 all encode the same isoform. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Reviews
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
"NM_000345" in other vectors (6)
| SKU | Description | Size | Price | |
|---|---|---|---|---|
| RC210606 | SNCA (Myc-DDK-tagged)-Human synuclein, alpha (non A4 component of amyloid precursor) (SNCA), transcript variant 1 | 10 ug |
$150.00
|
|
| RC210606L1 | Lenti ORF clone of Human synuclein, alpha (non A4 component of amyloid precursor) (SNCA), transcript variant 1, Myc-DDK-tagged | 10 ug |
$450.00
|
|
| RC210606L2 | Lenti ORF clone of Human synuclein, alpha (non A4 component of amyloid precursor) (SNCA), transcript variant 1, mGFP tagged | 10 ug |
$450.00
|
|
| RC210606L3 | Lenti ORF clone of Human synuclein, alpha (non A4 component of amyloid precursor) (SNCA), transcript variant 1, Myc-DDK-tagged | 10 ug |
$450.00
|
|
| RC210606L4 | Lenti ORF clone of Human synuclein, alpha (non A4 component of amyloid precursor) (SNCA), transcript variant 1, mGFP tagged | 10 ug |
$450.00
|
|
| RG210606 | SNCA (tGFP-tagged) - Human synuclein, alpha (non A4 component of amyloid precursor) (SNCA), transcript variant 1 | 10 ug |
$489.00
|
|
Citations
A mitochondrial membrane-bridging machinery mediates signal transduction of intramitochondrial oxidation
Li, Conradson, Bharat et al
Nat Metab (2021) 3 (9), 1242-1258 DOI: 10.1038/s42255-021-00443-2
Li, Conradson, Bharat et al
Nat Metab (2021) 3 (9), 1242-1258 DOI: 10.1038/s42255-021-00443-2
Cited by 58
AI Summary: OriGene’s pCMV6-XL5 vector containing human SNCA cDNA (no. SC119919) was used as the template to generate constructs for studying the role of SNCA in mitochondrial redox signaling in this paper.
Snippet: pJFRC8-40×UAS-SNCA was generated by PCR amplifying the human SNCA complementary DNA from the pCMV6-XL5 vector (no. SC119919, OriGene),
Cytotoxicity and Mitochondrial Dysregulation Caused by α-Synuclein in Dictyostelium discoideum
Fernando, Allan, Mroczek et al
Cells (2020) 9 (10) DOI: 10.3390/cells9102289
Fernando, Allan, Mroczek et al
Cells (2020) 9 (10) DOI: 10.3390/cells9102289
Cited by 10
AI Summary: OriGene’s human SNCA cDNA clone (NM_000345.2 in pCMV6-XL5 vector) was used as the template for PCR amplification of α-synuclein, enabling the study of its cytotoxicity and mitochondrial effects in Dictyostelium discoideum.
Snippet: top view of fruiting bodies, agar slices were cut and flipped over to observe the side view. 2.2. Plasmid Construction The human α-synuclein gene was amplified by PCR using a commercial cDNA clone (OrigeneTM, Rockville, MD, USA) containing the human SNCA gene (NM_000345.2) in the pCMV6-XL5 vector, as the template and primers SynprimF (PGCGC TCTAGA ATCGAT ATG GATGTATTCATGAAAGGACTTTCAAAGGCC) and
A Translocation Pathway for Vesicle-Mediated Unconventional Protein Secretion
Zhang, Liu, Lin et al
Cell (2020) 181 (3), 637-652.e15 DOI: 10.1016/j.cell.2020.03.031
Zhang, Liu, Lin et al
Cell (2020) 181 (3), 637-652.e15 DOI: 10.1016/j.cell.2020.03.031
Cited by 316
AI Summary: In this study, α-synuclein obtained from OriGene was used as a representative leaderless cargo protein to investigate the mechanisms of vesicle-mediated unconventional protein secretion.
Snippet: The mature forms of IL-1 family members (p-IL-1b from Russell Vance, p-IL-18 from Sinobiological, pIL-36RA, a, b,g and 37 from Dr. Xinquan Wang, the others were amplified from cDNA) were PCR amplified from templates of pro-forms and inserted into the FUGW vector with a FLAG tag at the C terminus. Mutagenesis was formed by PCR. mIL-1b, mIL-36a, mIL-37 and mIL-38 were inserted into PET28a vector for...
α-Synuclein impairs ferritinophagy in the retinal pigment epithelium: Implications for retinal iron dyshomeostasis in Parkinson's disease
Baksi, Singh
Sci Rep (2017) 7 (1), 12843 DOI: 10.1038/s41598-017-12862-x
Baksi, Singh
Sci Rep (2017) 7 (1), 12843 DOI: 10.1038/s41598-017-12862-x
AI Summary: OriGene’s human α-synuclein cDNA plasmid (SC119919) was used to express α-synuclein in experimental models, enabling the study of its role in impairing ferritinophagy and contributing to retinal iron dyshomeostasis in Parkinson's disease.
Snippet: …Briefly the human α-syn cDNA encoding plasmid was purchased from Origene, USA (SC119919) and subcloned in piggybac vector (Systems Biosciences, CA, USA). ...;... …Briefly the human α-syn cDNA encoding plasmid was purchased from Origene, USA (SC119919) and subcloned in piggybac vector (Systems Biosciences, CA, USA).
Alpha-synuclein modulates retinal iron homeostasis by facilitating the uptake of transferrin-bound iron: Implications for visual manifestations of Parkinson's disease
Baksi, Tripathi, Singh
Free Radic. Biol. Med. (2016)
Baksi, Tripathi, Singh
Free Radic. Biol. Med. (2016)
Cited by 63
AI Summary: OriGene's human α-synuclein plasmid (catalog #SC119919) was used to over-express α-synuclein in retinal pigment epithelial cells, enabling the authors to investigate its role in retinal iron uptake and homeostasis.
Snippet: The plasmid construct encoding human α-syn was purchased from origene, USA (SC119919), and sub-cloned into piggybac (#748) and piggybac EGFP (#740) vectors (Systems Biosciences, CA, USA) using 5′-GTCGACATGGATGTATTCATGAAAGGACTTTC −3′ ... Cite SaveSaving
A Bacteriophage Capsid Protein Provides a General Amyloid Interaction Motif (GAIM) That Binds and Remodels Misfolded Protein Assemblies
Krishnan, Tsubery, Proschitsky et al
J. Mol. Biol. (2014)
Krishnan, Tsubery, Proschitsky et al
J. Mol. Biol. (2014)
Cited by 67
AI Summary: OriGene’s full-length α-synuclein (NM_000345) was used as a key protein substrate to generate amyloid fibers for experiments assessing the binding and remodeling activity of the bacteriophage g3p protein in this study.
Snippet: Full length α-synuclein (NM_000345, Origene) was cloned into a pET21a (+) vector and expressed as described by Hoyer et.al..62 The purified protein was aggregated using 2 mM SDS as described by Ahmad et.al..63 The fibers were thoroughly dialyzed using a 30 Kd membrane (Slidelyzer, Pierce) to remove trace amounts of detergent and lower molecular weight α-synuclein species
Showing 1-6 of 8 papers.
Powered by BizGenius
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.
Related Products
- Price:
- Actual Price:
Welcome to OriGene AI!
I'm your AI-powered guide to everything OriGene.
Ask me anything:
- Product specs
- Ordering help
- Technical questions
- How to find exactly what your experiment needs
Prefer a live agent? Connect with us by clicking the green chat icon, as seen in the image below or email our team at custsupport@origene.com.
