OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

IRF1 (NM_002198) Human Untagged Clone

Be the first to review this product
SKU
SC118744
IRF1 (untagged)-Human interferon regulatory factor 1 (IRF1)
  $450.00
In Stock*
Bulk Requests & Clone Modifications

Frequently Bought Together (3)

TA323047 Anti-IRF1 Rabbit Polyclonal Antibody
100 ul
$305.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "IRF1 or NM_002198"

Specifications
Specifications
Product Data
Type Human Untagged Clone
Target Symbol IRF1
Synonyms IRF-1; MAR
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
Fully Sequenced ORF
>NCBI ORF sequence for NM_002198, the custom clone sequence may differ by one or more nucleotides


ATGCCCATCACTCGGATGCGCATGAGACCCTGGCTAGAGATGCAGATTAATTCCAACCAAATCCCGGGGC
TCATCTGGATTAATAAAGAGGAGATGATCTTCCAGATCCCATGGAAGCATGCTGCCAAGCATGGCTGGGA
CATCAACAAGGATGCCTGTTTGTTCCGGAGCTGGGCCATTCACACAGGCCGATACAAAGCAGGGGAAAAG
GAGCCAGATCCCAAGACGTGGAAGGCCAACTTTCGCTGTGCCATGAACTCCCTGCCAGATATCGAGGAGG
TGAAAGACCAGAGCAGGAACAAGGGCAGCTCAGCTGTGCGAGTGTACCGGATGCTTCCACCTCTCACCAA
GAACCAGAGAAAAGAAAGAAAGTCGAAGTCCAGCCGAGATGCTAAGAGCAAGGCCAAGAGGAAGTCATGT
GGGGATTCCAGCCCTGATACCTTCTCTGATGGACTCAGCAGCTCCACTCTGCCTGATGACCACAGCAGCT
ACACAGTTCCAGGCTACATGCAGGACTTGGAGGTGGAGCAGGCCCTGACTCCAGCACTGTCGCCATGTGC
TGTCAGCAGCACTCTCCCCGACTGGCACATCCCAGTGGAAGTTGTGCCGGACAGCACCAGTGATCTGTAC
AACTTCCAGGTGTCACCCATGCCCTCCACCTCTGAAGCTACAACAGATGAGGATGAGGAAGGGAAATTAC
CTGAGGACATCATGAAGCTCTTGGAGCAGTCGGAGTGGCAGCCAACAAACGTGGATGGGAAGGGGTACCT
ACTCAATGAACCTGGAGTCCAGCCCACCTCTGTCTATGGAGACTTTAGCTGTAAGGAGGAGCCAGAAATT
GACAGCCCAGGGGGGGATATTGGGCTGAGTCTACAGCGTGTCTTCACAGATCTGAAGAACATGGATGCCA
CCTGGCTGGACAGCCTGCTGACCCCAGTCCGGTTGCCCTCCATCCAGGCCATTCCCTGTGCACCGTAG

5' Read Nucleotide Sequence
>OriGene 5' read for NM_002198 unedited
TTTTGTAATACGACTCACTATAGGGCGGCCGCGAATTCGGCACGAGGCTTAGTCGAGGCA
AGACGTGCGCCCGAGCCCCGCCGAACCGAGGCCACCCGGAGCCGTGCCCAGTCCACGCCG
GCCGTGCCCGGCGGCCTTAAGAACCCGGCAACCTCTGCCTTCTTCCCTCTTCCACTCGGA
GTCGCGCTTCGCGCGCCCTCACTGCAGCCCCTGCGTCGCCGGGACCCTCGCGCGCGACCG
CCGAATCGCTCCTGCAGCAGAGCCAACATGCCCATCACTCGGATGCGCATGAGACCCTGG
CTAGAGATGCAGATTAATTCCAACCAAATCCCGGGGCTCATCTGGATTAATAAAGAGGAG
ATGATCTTCCAGATCCCATGGAAGCATGCTGCCAAGCATGGCTGGGACATCAACAAGGAT
GCCTGTTTGTTCCGGAGCTGGGCCATTCACACAGGCCGATACAAAGCAGGGGAAAAGGAG
CCAGATCCCAAGACGTGGAAGGCCAACTTTCGCTGTGCCATGAACTCCCTGCCAGATATC
GAGGAGGTGAAAGACCAGAGCAGGAACAAGGGCAGCTCAGCTGTGCGAGTGTACCGGATG
CTTCCACCTCTCACCAAGAACCAGAGAAAAGAAAGAAGGTTCGAAGTCCAGCCGAGATGC
TAAGAGCAAGGCCAGNNAGGAAGTCATGTGGGGGGATTCCAGCCCTGATACCTTCTCTGA
TGGACTCAGCAGCTCCACTCTGCCTGATGACCACAGCACCTACACAGTTCCAGGCTCATG
CAGACTTTGGGAGGGGGGAACAGGCCCTGACTCACCTGGNNNCCCCGGGTGCTGTCACAG
CACTCTCCCCGACTGCACATCCAAANGGGAAAGGTGGCGCGGACAGACCCCGGGATCTGT
CAACT
3' Read Nucleotide Sequence
>OriGene 3' read for NM_002198 unedited
GGCACGCAATCTAAAGTCGAGTTTTTTTTTTTTTTTTTTTTTTGGGGCCCGGGCTGGAGT
GCAATGGCATGTTCTCGGCTCACTGCAACCTCCACCTCCCAGGTTCAAGCGATTCTCTTG
CCTCAGCCTCCTGAGTAGCTGGGATTACAAGCACCCGCAACCACGCCCAGCTAATTTTTG
CATTTTTAGTAAAAATGGAGTTTCACCAGGCTGGTCTCAAACTCCTGACCTCAGGTGATC
CACCCATCTCGGCCTCCCAAAGTGCTGGGATTACAGGTGTGAGCCACCGCGCCTGTCCGA
AAGGATTTTATAACAGATGCATGTCCCTGTTCACCCCAAAGTCAAGTTCAAGCGGGATGC
CAATAATAAGTCCATCAGTGTTTCCATAAAAAGTAAAATCATCTACAAGGCAAATTTCTC
TCTAAAAAGGCCACACCCTTATAAACAATTTACTTTTTTATAAAAAGACAAATGTACATA
TTTACACACGTCCTTATGTGTTCACACATGACTTAAAGGCTAAATGACATTTACAATTTT
AAGTTATACCAAGGCGCCTCACACTTACCTCCCTGGGCCCTGTTGAAGGCCTGCTGGGGC
TTGAAGGGGCGGTGGGCCCCTAGCCACGCCCTGTTTAAATAAACGCAAAGGCCAAAATCT
CGGTGGAAAAGTTAATGCTCACCCCTGATCAAAATGTGGCTTGATCCCACCAAAAATTCC
AATTGTTTTTCCCACTCCCCCCCCCATCAGGAGCCCAGGACACCCCTCTGAGGCTGAGGA
ACCCTGCCCAGAAGAACCCCTTTTCCTCAATATACCGCGTTTGGAACACACCCCCGGCTA
TTTTAAATGGGGTTATTTTTTGCAACCAAATATATATCGCCATTTTTTTACCGCATACCC
ACCTGGATCGTGCCTTACACCCTGCGCCCCCGCCCGATCCCAGTCACATCCTTTTCNTTA
TACCCCTTCACACCGGAC
Restriction Sites NotI-NotI |
ACCN NM_002198
Insert Size 2600 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_002198.1, NP_002189.1
RefSeq Size 2035 bp
RefSeq ORF 978 bp
Locus ID 3659
UniProt ID P10914
Cytogenetics 5q31.1
Domains IRF
Protein Families Druggable Genome, Transcription Factors
Summary The protein encoded by this gene is a transcriptional regulator and tumor suppressor, serving as an activator of genes involved in both innate and acquired immune responses. The encoded protein activates the transcription of genes involved in the body's response to viruses and bacteria, playing a role in cell proliferation, apoptosis, the immune response, and DNA damage response. This protein represses the transcription of several other genes. As a tumor suppressor, it both suppresses tumor cell growth and stimulates an immune response against tumor cells. Defects in this gene have been associated with gastric cancer, myelogenous leukemia, and lung cancer. provided by RefSeq, Aug 2017
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_002198" in other vectors (6)
SKU Description Size Price
RC203500 IRF1 (Myc-DDK-tagged)-Human interferon regulatory factor 1 (IRF1) 10 ug
$450.00
RC203500L1 Lenti ORF clone of Human interferon regulatory factor 1 (IRF1), Myc-DDK-tagged 10 ug
$750.00
RC203500L2 Lenti ORF clone of Human interferon regulatory factor 1 (IRF1), mGFP tagged 10 ug
$750.00
RC203500L3 Lenti ORF clone of Human interferon regulatory factor 1 (IRF1), Myc-DDK-tagged 10 ug
$750.00
RC203500L4 Lenti ORF clone of Human interferon regulatory factor 1 (IRF1), mGFP tagged 10 ug
$750.00
RG203500 IRF1 (tGFP-tagged) - Human interferon regulatory factor 1 (IRF1) 10 ug
$650.00

file-alt Citations

Interferon regulatory factor 1 (IRF1) inhibits lung endothelial regeneration following inflammation-induced acute lung injury
Chen, Qi, Fan et al
Clin Sci (Lond) (2023) 137 (5), 367-383 DOI: 10.1042/CS20220876
AI Summary: OriGene products contributed to this study by providing qPCR primers and the murine Irf1 cDNA clone (cat. no. MC200482), which were used to analyze gene expression and generate constructs for functional experiments investigating the role of IRF1 in lung endothelial regeneration.
Snippet: …Immunoblotting Following cell isolation, cells were lysed using RIPA buffer (Sigma) supplemented with protease and phosphatase i;Next, the murine Irf1 cDNA clone (NM_008390, cat. … MC200482, Origene) was inserted into the pcDNA-Cdh5 vector
FigureFigureFigure
iNOS/NO is required for IRF1 activation in response to liver ischemia-reperfusion in mice
Du, Luo, Yang et al
Mol. Med. (2020) 26 (1), 56 DOI: 10.1186/s10020-020-00182-2
Cited by 17
AI Summary: OriGene products, specifically the human TP53 and IRF1 expression plasmids (pCMV6-xl5-TP53 and pCMV6-xl5-hIRF1), were used in this study to investigate the roles of these genes in iNOS/NO-mediated IRF1 activation and PUMA expression during liver ischemia-reperfusion in mice.
Snippet: Human TP53 and IRF1 expression plasmids, pCMV6-xl5-TP53 and pCMV6-xl5-hIRF1 were purchased from Origene, Rockville, MD
FigureFigureFigure
Immune mediators regulate CFTR expression through a bifunctional airway-selective enhancer
Zhang, Leir, Harris
Mol. Cell. Biol. (2013) 33 (15), 2843-53 DOI: 10.1128/MCB.00003-13
Cited by 1
AI Summary: OriGene’s IRF1 (SC118744) and IRF2 cDNA clones were used in this study to overexpress these transcription factors in airway epithelial cells, enabling the authors to investigate their roles in regulating CFTR gene expression.
Snippet: RNAiMAX (Life Technologies, Grand Island, NY) per the manufacturer's protocol. Cells 130 were harvested 72 hrs after transfection to isolate whole cell lysate and total RNA. 131 cDNA clones of IRF1 (SC118744, OriGene Technologies Rockville, MD), IRF2 132
Dysregulation of interferon regulatory factors impairs the expression of immunostimulatory molecules in hepatitis C virus genotype 1-infected hepatocytes
Larrea, Riezu-Boj, Aldabe et al
Gut (2013)
Cited by 22
AI Summary: In this study, OriGene products including the IRF2 expression plasmid (OriGene, RC210614) and IRF2 siRNA (OriGene, SR300095) were used to manipulate IRF2 levels in Huh7 cells, enabling the authors to demonstrate that IRF2 regulates IL-7 and IL-15Rα expression in the context of hepatitis C virus infection.
Snippet: Menu. Search BMJ Group Search BMJ Group.
IRF-1 and miRNA126 modulate VCAM-1 expression in response to a high-fat meal
Sun, Alkhoury, Wang et al
Circ. Res. (2012) 111 (8), 1054-64 DOI: 10.1161/CIRCRESAHA.112.270314
AI Summary: In this study, the pCMV6-XL5/human IRF-1 plasmid from OriGene was used to overexpress IRF-1 in human aortic endothelial cells, enabling the researchers to investigate the role of IRF-1 in modulating VCAM-1 expression in response to triglyceride-rich lipoproteins after a high-fat meal.
Snippet: transfected with 150 pmol siRNA (Santa Cruz Biotech), miR-126 inhibitor (Dharmcon), or 3 µg pCMV6-XL5/human Irf-1 (OriGene) using a 4D ... resistant mice.29 Oleic acid (C18:1n9), also elevated in anti-atherogenic TGRL, can reduce the inflammatory effects of long-chain SFAs
Virus-activated interferon regulatory factor 7 upregulates expression of the interferon-regulated BST2 gene independently of interferon signaling
Bego, Mercier, Cohen
J Virol (2012) 86 (7), 3513-27 DOI: 10.1128/JVI.06971-11
AI Summary: In this study, OriGene products—specifically, the IRF-1, IRF-3, and IRF-7 expression plasmids—were used to investigate how these transcription factors regulate BST2 gene expression independently of interferon signaling.
Showing 1-6 of 6 papers.
Powered by BizGenius
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products