OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

MIF (NM_002415) Human Untagged Clone

Be the first to review this product
SKU
SC118641
MIF (untagged)-Human macrophage migration inhibitory factor (glycosylation-inhibiting factor) (MIF)
  $150.00
In Stock*
Bulk Requests & Clone Modifications

Frequently Bought Together (4)

TA303028 Goat Polyclonal Antibody against MIF
100 ug
$565.00
CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "MIF or NM_002415"

Specifications
Specifications
Product Data
Type Human Untagged Clone
Target Symbol MIF
Synonyms GIF; GLIF; MMIF
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
Fully Sequenced ORF
>OriGene ORF within SC118641 sequence for NM_002415 edited (data generated by NextGen Sequencing)
ATGCCGATGTTCATCGTAAACACCAACGTGCCCCGCGCCTCCGTGCCGGACGGGTTCCTC
TCCGAGCTCACCCAGCAGCTGGCGCAGGCCACCGGCAAGCCCCCCCAGTACATCGCGGTG
CACGTGGTCCCGGACCAGCTCATGGCCTTCGGCGGCTCCAGCGAGCCGTGCGCGCTCTGC
AGCCTGCACAGCATCGGCAAGATCGGCGGCGCGCAGAACCGCTCCTACAGCAAGCTGCTG
TGCGGCCTGCTGGCCGAGCGCCTGCGCATCAGCCCGGACAGGGTCTACATCAACTATTAC
GACATGAACGCGGCCAATGTGGGCTGGAACAACTCCACCTTCGCCTAA

Clone variation with respect to NM_002415.1
5' Read Nucleotide Sequence
>OriGene 5' read for NM_002415 unedited
GTCAGATTTTGTAATACGACTTCACTATAGGGCGGCCGCGAATTCGCACGAGGGCGGCGC
GTGCGTCTGTGCCTCTGCGCGGGTCTCCTGGTCCTTCTGCCATCATGCCGATGTTCATCG
TAAACACCAACGTGCCCCGCGCCTCCGTGCCGGACGGGTTCCTCTCCGAGCTCACCCAGC
AGCTGGCGCAGGCCACCGGCAAGCCCCCCCAGTACATCGCGGTGCACGTGGTCCCGGACC
AGCTCATGGCCTTCGGCGGCTCCAGCGAGCCGTGCGCGCTCTGCAGCCTGCACAGCATCG
GCAAGATCGGCGGCGCGCAGAACCGCTCCTACAGCAAGCTGCTGTGCGGCCTGCTGGCCG
AGCGCCTGCGCATCAGCCCGGACAGGGTCTACATCAACTATTACGACATGAACGCGGCCA
ATGTGGGCTGGAACAACTCCACCTTCGCCTAAGAGCCGCAGGGACCCACGCTGTCTGCGC
TGGCTCCACCCGGGAACCCGCCGCACGCTGTGTTCTAGGCCCGCCCACCCCAACCTTCTG
GTGGGGAGAAATAAACGGTTTAGAGACTAAAAAAAAAAAAAAAAAACTCGACTCTAGATT
GCGGCCGCGGTCATAGCTGTTTCCTGAACAGATCCCGGGTGGCATCCCTGTGACCCCTCC
CCAGTGCCTCTCCTGGCCCCTGGAAGTTGCCACTCCAGTGCCCACCAGCCCTTGTCCTAA
TAAAATTAAGCTGCATCATTTTGCCTGACCAGGTGTCCCTTCATAATATTATGGGTGGCA
GGGGGTTGCTATGGACCAAGGGGCAAGTTGGGAAGAACACCTGTAGGCCCGCCGGGTCTA
TTGGGACCCAACCGGGAGGCCAGGGACCAATCTGGCTCACTGGAATCCCGCCTCCTGAGT
CAAGCGAATCTCCTGCCT
3' Read Nucleotide Sequence
>OriGene 3' read for NM_002415 unedited
ACTTCCAGGGCCAGGAAGCACTGGGGAGGGTCACAGGGATGCCACCCGGGATCTGTCAGA
AACAGCTATGACCGCGGCCGCAATCTANAGTCGAGTTTTTTTTTTTTTTTTTTAGTCTCT
AAACCGTTTATTTCTCCCCACCAGAAGGTTGGGGTGGGCGGGCCTAGAACACAGCGTGCG
GCGGGTTCCCGGGTGGAGCCAGCGCAGACAGCGTGGGTCCCTGCGGCTCTTAGGCGAAGG
TGGAGTTGTTCCAGCCCACATTGGCCGCGTTCATGTCGTAATAGTTGATGTAGACCCTGT
CCGGGCTGATGCGCAGGCGCTCGGCCAGCAGGCCGCACAGCAGCTTGCTGTAAGAGCGGT
TCTGCGCGCCGCCGATCTTGCCGATGCTGTGCAGGCTGCAGAGCGCGCACGGCTCGNNNG
AGCCGCCGAAGGCCATGAGCTGGTCCGGGACCACGTGCACCGCGATGTACTGGGGGGGCT
TGCCGGTGGCCTGCGCCAGCTGCTGNGTGAGCTCGGAAGGAACCCGTCCGGCACGGAGGC
GCGGGGCACGTTGGTGTTTACGATGAACATCGGCATGATGGCAGAAGGACCAGGAGACCC
GCGCAGAGGCACAGACGCACGCGCCGNCCTCGTGCCGAATTCGCGGCCGCCCTATAGTGA
GTCGTATTCAAAATTCTGACGGTTCACTAAACGAGCTCTGCTTTATAGNACCTCCACCGT
ACACGCCTACCGCCCATNNNNCCAACGGGCCGGGTTATTACGACATTNTGGAAAGTNCCG
TTGATTTTTGTGCCAAACAAACTCTCATTGACGTCAATGGGGTGGGAGACTTGNAAATTC
CCGGAGTTCAACCGCTATTCCGCCCATTGGTGTTCTGCCAAAACGNCACACCATGGNATA
GCGATGACTAATCGTANNAGTACTGCCAGTAGNAAAGTCCCGAG
Restriction Sites NotI-NotI |
ACCN NM_002415
Insert Size 560 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_002415.1, NP_002406.1
RefSeq Size 561 bp
RefSeq ORF 348 bp
Locus ID 4282
UniProt ID P14174
Cytogenetics 22q11.23
Domains MIF
Protein Families Druggable Genome
Protein Pathways Phenylalanine metabolism, Tyrosine metabolism
Summary This gene encodes a lymphokine involved in cell-mediated immunity, immunoregulation, and inflammation. It plays a role in the regulation of macrophage function in host defense through the suppression of anti-inflammatory effects of glucocorticoids. This lymphokine and the JAB1 protein form a complex in the cytosol near the peripheral plasma membrane, which may indicate an additional role in integrin signaling pathways. provided by RefSeq, Jul 2008
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_002415" in other vectors (6)
SKU Description Size Price
RC205106 MIF (Myc-DDK-tagged)-Human macrophage migration inhibitory factor (glycosylation-inhibiting factor) (MIF) 10 ug
$150.00
RC205106L1 Lenti ORF clone of Human macrophage migration inhibitory factor (glycosylation-inhibiting factor) (MIF), Myc-DDK-tagged 10 ug
$450.00
RC205106L2 Lenti ORF clone of Human macrophage migration inhibitory factor (glycosylation-inhibiting factor) (MIF), mGFP tagged 10 ug
$450.00
RC205106L3 Lenti ORF clone of Human macrophage migration inhibitory factor (glycosylation-inhibiting factor) (MIF), Myc-DDK-tagged 10 ug
$450.00
RC205106L4 Lenti ORF clone of Human macrophage migration inhibitory factor (glycosylation-inhibiting factor) (MIF), mGFP tagged 10 ug
$450.00
RG205106 MIF (tGFP-tagged) - Human macrophage migration inhibitory factor (glycosylation-inhibiting factor) (MIF) 10 ug
$489.00

file-alt Citations

microRNA-1228(⁎) impairs the pro-angiogenic activity of gastric cancer cells by targeting macrophage migration inhibitory factor
Jia, Chen, Xie et al
Life Sci. (2017)
AI Summary: OriGene’s MIF cDNA was used as a template to amplify the 3′-UTR of MIF mRNA for luciferase reporter assays, enabling the study to demonstrate that miR-1228(*) directly targets MIF to impair the pro-angiogenic activity of gastric cancer cells.
Snippet: 10]. The 3′-UTR of MIF mRNA was amplified by PCR using MIF cDNA (Origene, Rockville, MD, USA) as a template and then cloned into the pMIR-REPORT luciferase plasmid (Applied Biosystems, Foster City, CA, USA). Mutation ... All 2 versions Cite SaveSaving
Ellagic Acid, a Dietary Polyphenol, Inhibits Tautomerase Activity of Human Macrophage Migration Inhibitory Factor and Its Pro-inflammatory Responses in Human Peripheral Blood Mononuclear Cells
Sarkar, Siddiqui, Mazumder et al
J. Agric. Food Chem. (2015) 63 (20), 4988-98 DOI: 10.1021/acs.jafc.5b00921
Cited by 39
AI Summary: OriGene’s pCMV6-XL5 cloning vector was used to clone full-length human MIF cDNA, enabling the overexpression and purification of MIF protein for functional assays in the study.
Snippet: Overexpression and Purification of Human MIF Human MIF was cloned by following the protocol as described earlier with slight modification.(37) In brief, full length MIF cDNA was cloned using pCMV6-XL5 cloning vector obtained from ORIGENE USA. ... Cite SaveSaving
Macrophage Migration Inhibitory Factor Regulates Akt Signaling in Hypoxic Culture to Modulate Senescence of Human Mesenchymal Stem Cells
Palumbo, Tsai, Li
Stem Cells Dev. (2013)
Cited by 49
AI Summary: OriGene products contributed to this study by providing the pCMV6-Entry vector containing the MIF gene for overexpression and the HuSH pGFP-V-RS control shRNA plasmid, which were used to manipulate MIF expression and investigate its role in regulating Akt signaling and senescence in human mesenchymal stem cells.
Snippet: To construct a plasmid for MIF overexpression, referred to as MIFover, the coding sequence of MIF gene of the pCMV6-Entry vector (Origene, Rockville, MD) was isolated by ... HuSH pGFP-V-RS (Origene). The control shRNA plasmid containing a non-specific scrambled ... Cite SaveSaving
Novel anti-inflammatory activity of epoxyazadiradione against macrophage migration inhibitory factor: inhibition of tautomerase and proinflammatory activities of macrophage migration inhibitory factor
Alam, Haldar, Thulasiram et al
J. Biol. Chem. (2012) 287 (29), 24844-61 DOI: 10.1074/jbc.M112.341321
Cited by 4
AI Summary: OriGene contributed to this study by providing the full-length human MIF (huMIF) cDNA cloned into the pCMV6-XL5 vector, which was used for cloning and expression experiments.
Snippet: Natural product-based anti-inflammatory agents with good efficacy and lower risk of side effects are in global demand to treat and prevent inflammation-related ... For the cloning of huMIF, full-length huMIF cDNA cloned into pCMV6-XL5 cloning vector was obtained from OriGene.
Showing 1-4 of 4 papers.
Powered by BizGenius
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products