OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

ARFRP1 (NM_003224) Human Untagged Clone

Be the first to review this product
SKU
SC118098
ARFRP1 (untagged)-Human ADP-ribosylation factor related protein 1 (ARFRP1), transcript variant 1
  $300.00
4 Weeks*
Bulk Requests & Clone Modifications

Frequently Bought Together (4)

TA350878 Rabbit Polyclonal Anti-ARFRP1 Antibody
100 ul
$205.00
CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "ARFRP1 or NM_003224"

Specifications
Specifications
Product Data
Type Human Untagged Clone
Target Symbol ARFRP1
Synonyms ARL18; ARP; Arp1
Vector pCMV6-XL4
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
Fully Sequenced ORF
>NCBI ORF sequence for NM_003224, the custom clone sequence may differ by one or more nucleotides


ATGTACACGCTGCTGTCGGGCTTGTACAAGTACATGTTTCAGAAGGACGAGTACTGCATCCTGATCCTGG
GCCTGGACAATGCTGGGAAGACGACCTTCCTGGAGCAGTCGAAAACCCGATTTAACAAGAACTACAAGGG
GATGAGTCTATCCAAAATCACCACCACCGTGGGCCTAAACATCGGCACTGTGGATGTGGGAAAGGCTCGG
CTCATGTTCTGGGACTTAGGAGGGCAGGAAGAGCTGCAGTCTTTGTGGGACAAGTATTATGCGGAGTGTC
ACGGCGTCATCTACGTCATTGACTCCACCGACGAGGAGAGGCTGGCTGAGTCCAAGCAGGCGTTTGAGAA
GGTGGTGACCAGCGAGGCGCTGTGCGGTGTCCCCGTCTTGGTGCTGGCCAACAAGCAGGATGTGGAGACG
TGCCTCTCAATCCCTGACATCAAGACGGCCTTCAGCGACTGCACCAGCAAGATCGGCAGGCGAGATTGCC
TGACCCAGGCCTGCTCGGCCCTCACAGGCAAAGGGGTGCGCGAGGGCATCGAGTGGATGGTGAAGTGTGT
CGTGCGGAATGTGCACCGGCCGCCGCGGCAGAGGGACATCACGTAG

5' Read Nucleotide Sequence
>OriGene 5' read for NM_003224 unedited
NGTCACCATTTGTATACGACTCATATAGGGCGGCCGCGATTCGGCACGAGGCGGTTCAGC
TCATTCCCTGAGGCCGGCCCGCGTCCCGTCAGGCGCCGCGCGGGGTTAGCGCGGGGTCAG
CGGAGGTCAGCGGGGGTCAGCAGCAGCGGCTCCGAGGGCGCGGCGGACGCAGGATGTACA
CGCTGCTGTCGGGCTTGTACAAGTACATGTTTCAGAAGGACGAGTACTGCATCCTGATCC
TGGGCCTGGACAATGCTGGGAAGACGACCTTCCTGGAGCAGTCGAAAACCCGATTTAACA
AGAACTACAAGGGGATGAGTCTATCCAAAATCACCACCACCGTGGGCCTAAACATCGGCA
CTGTGGATGTGGGAAAGGCTCGGCTCATGTTCTGGGACTTAGGAGGGCAGGAAGAGCTGC
AGTCTTTGTGGGACAAGTATTATGCGGAGTGTCACGGCGTCATCTACGTCATTGACTCCA
CCGACNAGGAGAGGCTGGCTGAGTCCAAGCAGGCGTTTGAGAAGGTGGTGACCAGCGAGG
CGCTGTGCGGTGTCCCCGTCTTGGTGCTGGCCAACAAGCAGGATGTGGAGACGTGCCTCT
CAATCCCTGACATCAAGACGGCCTTCAGCGACTGCACCAGCAAGATCGGCAGGCGCGATT
GCCTGACCCANGCCTGCTCGGCCCTCACAGGCAAAGGGGTGCGCGAGGGCATCGAGTGGA
TGGTGAAGTGTGTCGTGCGGAATGTGCACCGGCCGCCGCGGCAGAAGGACATCACGTAGG
CGCAGCCGCGCTGCCGTCGGGACGGCTGGTCCCCTGGTGCTGGNAGAGTGGCCTCNCTGT
GGCTCCATGCTGCTGATCTGGGGGGGTGGGTNTGCCTTGCTNTGGGGNNTCTCTATTTAC
TTTTGTTTCTCGAAGACAACTTTNCTCTTGTCTGGAAAGCGTNAGCTNNCGAC
Restriction Sites NotI-NotI |
ACCN NM_003224
Insert Size 1750 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_003224.2, NP_003215.1
RefSeq Size 1741 bp
RefSeq ORF 606 bp
Locus ID 10139
UniProt ID Q13795
Cytogenetics 20q13.33
Domains arf, ARF, RAB, SAR
Summary The protein encoded by this gene is a membrane-associated GTP-ase which localizes to the plasma membrane and is related to the ADP-ribosylation factor (ARF) and ARF-like (ARL) proteins. This gene plays a role in membrane trafficking between the trans-Golgi network and endosomes. Alternatively spliced transcript variants encoding different isoforms have been identified. provided by RefSeq, May 2012
Transcript Variant: This variant (1) represents the longest isoform (A). Variants 1, 6, and 7 encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_003224" in other vectors (4)
SKU Description Size Price
RC210518 ARFRP1 (Myc-DDK-tagged)-Human ADP-ribosylation factor related protein 1 (ARFRP1), transcript variant 1 10 ug
$300.00
RC210518L3 Lenti ORF clone of Human ADP-ribosylation factor related protein 1 (ARFRP1), transcript variant 1, Myc-DDK-tagged 10 ug
$600.00
RC210518L4 Lenti ORF clone of Human ADP-ribosylation factor related protein 1 (ARFRP1), transcript variant 1, mGFP tagged 10 ug
$600.00
RG210518 ARFRP1 (tGFP-tagged) - Human ADP-ribosylation factor related protein 1 (ARFRP1), transcript variant 1 10 ug
$489.00 $500.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products