OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

AGFG1 (NM_004504) Human Untagged Clone

Be the first to review this product
SKU
SC117306
AGFG1 (untagged)-Human ArfGAP with FG repeats 1 (AGFG1), transcript variant 2
  $524.00
In Stock*
Bulk Requests & Clone Modifications

Frequently Bought Together (4)

TA368906 AGFG1 rabbit polyclonal antibody
100 ul
$310.00
CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "AGFG1 or NM_004504"

Specifications
Specifications
Product Data
Type Human Untagged Clone
Target Symbol AGFG1
Synonyms HRB; RAB; RIP
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
Fully Sequenced ORF
>NCBI ORF sequence for NM_004504, the custom clone sequence may differ by one or more nucleotides


ATGGCGGCCAGCGCGAAGCGGAAGCAGGAGGAGAAGCACCTGAAGATGCTGCGGGACATGACCGGCCTCC
CGCACAACCGAAAGTGCTTCGACTGCGACCAGCGCGGCCCCACCTACGTTAACATGACGGTCGGCTCCTT
CGTGTGTACCTCCTGCTCCGGCAGCCTGCGAGGATTAAATCCACCACACAGGGTGAAATCTATCTCCATG
ACAACATTCACACAACAGGAAATTGAATTCTTACAAAAACATGGAAATGAAGTCTGTAAACAGATTTGGC
TAGGATTATTTGATGATAGATCTTCAGCAATTCCAGACTTCAGGGATCCACAAAAAGTGAAAGAGTTTCT
ACAAGAAAAGTATGAAAAGAAAAGATGGTATGTCCCGCCAGAACAAGCCAAAGTCGTGGCATCAGTTCAT
GCATCTATTTCAGGGTCCTCTGCCAGTAGCACAAGCAGCACACCTGAGGTCAAACCACTGAAATCTCTTT
TAGGGGATTCTGCACCAACACTGCACTTAAATAAGGGCACACCTAGTCAGTCCCCAGTTGTAGGTCGTTC
TCAAGGGCAGCAGCAGGAGAAGAAGCAATTTGACCTTTTAAGTGATCTCGGCTCAGACATCTTTGCTGCT
CCAGCTCCTCAGTCAACAGCTACAGCCAATTTTGCTAACTTTGCACATTTCAACAGTCATGCAGCTCAGA
ATTCTGCAAATGCAGATTTTGCAAACTTTGATGCATTTGGACAGTCTAGTGGTTCGAGTAATTTTGGAGG
TTTCCCCACAGCAAGTCACTCTCCTTTTCAGCCCCAAACTACAGGTGGAAGTGCTGCATCAGTAAATGCT
AATTTTGCTCATTTTGATAACTTCCCCAAATCCTCCAGTGCTGATTTTGGAACCTTCAATACTTCCCAGA
GTCATCAAACAGCATCAGCTGTTAGTAAAGTTTCAACGAACAAAGCTGGTTTACAGACTGCAGACAAATA
TGCAGCACTTGCTAATTTAGACAATATCTTCAGTGCCGGGCAAGGTGGTGATCAGGGAAGTGGCTTTGGG
ACCACAGGTAAAGCTCCTGTTGGTTCTGTGGTTTCAGTTCCCAGTCAGTCAAGTGCATCTTCAGACAAGT
ATGCAGCTCTGGCAGAACTAGACAGCGTTTTCAGTTCTGCAGCCACCTCCAGTAATGCGTATACTTCCAC
AAGTAATGCTAGCAGCAATGTTTTTGGAACAGTGCCAGTGGTTGCTTCTGCACAGACACAGCCTGCTTCA
TCAAGTGTGCCTGCTCCATTTGGAGCTACGCCTTCCACAAATCCATTTGTTGCTGCTGCTGGTCCTTCTG
TGGCATCTTCTACAAACCCATTTCAGACCAATGCCAGAGGAGCAACAGCGGCAACCTTTGGCACTGCATC
CATGAGCATGCCCACAGGATTCGGCACTCCTGCTCCCTACAGTCTTCCCACCAGCTTTAGTGGCAGCTTT
CAGCAGCCTGCCTTTCCAGCCCAAGCAGCTTTCCCTCAACAGACAGCTTTTTCTCAACAGCCCAATGGTG
CAGGTTTTGCAGCATTTGGACAAACAAAGCCAGTAGTAACCCCTTTTGGTCAAGTTGCAGCTGCTGGAGT
ATCTAGTAATCCTTTTATGACTGGTGCACCAACAGGACAATTTCCAACAGGAAGCTCATCAACCAATCCT
TTCTTATAG
Chromatograms Chromatograms
Sequencher program is needed, download here
Restriction Sites NotI-NotI |
ACCN NM_004504
Insert Size 2570 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_004504.3, NP_004495.2
RefSeq Size 4878 bp
RefSeq ORF 1689 bp
Locus ID 3267
UniProt ID P52594
Cytogenetics 2q36.3
Domains ArfGap
Summary The protein encoded by this gene is related to nucleoporins, a class of proteins that mediate nucleocytoplasmic transport. The encoded protein binds the activation domain of the human immunodeficiency virus Rev protein when Rev is assembled onto its RNA target, and is required for the nuclear export of Rev-directed RNAs. Multiple transcript variants encoding different isoforms have been found for this gene. provided by RefSeq, Sep 2008
Transcript Variant: This variant (2) lacks an alternate in-frame exon and uses an alternate in-frame splice site in the 3' coding region, compared to variant 1, resulting in a shorter protein (isoform 2), compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data because no single transcript was available for the full length of the gene. The extent of this transcript is supported by transcript alignments.
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_004504" in other vectors (6)
SKU Description Size Price
RC205375 AGFG1 (Myc-DDK-tagged)-Human ArfGAP with FG repeats 1 (AGFG1), transcript variant 2 10 ug
$523.00
RC205375L1 Lenti ORF clone of Human ArfGAP with FG repeats 1 (AGFG1), transcript variant 2, Myc-DDK-tagged 10 ug
$823.00
RC205375L2 Lenti ORF clone of Human ArfGAP with FG repeats 1 (AGFG1), transcript variant 2, mGFP tagged 10 ug
$823.00
RC205375L3 Lenti ORF clone of Human ArfGAP with FG repeats 1 (AGFG1), transcript variant 2, Myc-DDK-tagged 10 ug
$823.00
RC205375L4 Lenti ORF clone of Human ArfGAP with FG repeats 1 (AGFG1), transcript variant 2, mGFP tagged 10 ug
$823.00
RG205375 AGFG1 (tGFP-tagged) - Human ArfGAP with FG repeats 1 (AGFG1), transcript variant 2 10 ug
$489.00 $723.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products