OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

SNAPC5 (NM_006049) Human Untagged Clone

Be the first to review this product
SKU
SC116378
SNAPC5 (untagged)-Human small nuclear RNA activating complex, polypeptide 5, 19kDa (SNAPC5)
  $150.00
In Stock*
Bulk Requests & Clone Modifications

Frequently Bought Together (4)

TA368408 SNAPC5 rabbit polyclonal antibody
100 ul
$310.00
CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "SNAPC5 or NM_006049"

Specifications
Specifications
Product Data
Type Human Untagged Clone
Target Symbol SNAPC5
Synonyms SNAP19
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
Fully Sequenced ORF
>NCBI ORF sequence for NM_006049, the custom clone sequence may differ by one or more nucleotides


ATGCTGAGCCGGCTTCAGGAACTGCGCAAGGAGGAGGAGACGCTGCTGCGGTTGAAGGCAGCCCTGCACG
ACCAGCTGAACCGCCTCAAGGTTGAAGAATTAGCCCTCCAATCAATGATCAGTTCTAGAAGAGGGGATGA
GATGCTGTCTTCTCACACTGTACCTGAACAGTCACATGATATGTTGGTGCATGTAGACAATGAAGCATCA
ATCAACCAAACAACCCTGGAGCTGAGCACAAAGAGTCATGTGACGGAAGAGGAGGAGGAGGAAGAGGAAG
AAGAATCAGATTCCTAA

5' Read Nucleotide Sequence
>OriGene 5' read for NM_006049 unedited
GACATTGTAATCGACTCCTATAGGCGGCCGCGACATTCGCACGAGGGCAGCCCGGAGGTT
GGCTTGTGACCGGCAACATGCTGAGCCGGCTTCAAGAACTGCGCAAGGAGGAGGAGACGC
TGCTGCGGTTGAAGGCAGCCCTGCACGACCAGCTGAACCGCCTCAAGGTTGAAGAATTAG
CCCTCCAATCAATGATCAGTTCTAGAAAGAGGGGATGAAATGCTGTCTTCTCACACTGTA
CCTGAACAGTCACATGATATGTTGGTGCATGTAGACAATGAAGCATCAATCAACCAAACA
ACCCTGGAGCTGAGCACAAAGAGTCATGTGACGGAAGAGGAGGAGGAGGAAGAGGAAGAA
GAATCAGATTCCTAAAGGAGGGGGAAAGCCAGGCTGGTCAGTTATACAAATTGCATTTCT
AAGGCTCAGGCTACTTCTCCTCAAGGAAATCATCTTGCCCTGGGCCCTGTGATCTGCTTG
AAAGGAAAGCAAGAACTATAAGGAGGATGTGTAGTTGCAAAAATGGCTCCATCGGTAACT
CAAGCTTCAGAATGTTATGACATACAGAAAATCAAAGAATGCTGTGTCTTAGCATTGAGA
ATATGGGTGGGTGCTGTCTGTAATCTGGTCAGATTCAGTTAACTGTTCAGAAANAATTTC
CTCTGAAATACTGTTGAGAAAGTCTGTCATTTGCAAAAGAGCAGAGTTTAATACAAGCCA
GTCTTTCCAGTCAACATGCCTCTTTGAAGAAAACCATTAANGACTGTTGCATGCCGCTGA
ACCCTTGTGAGCAGTTAGAACACAGTCTAGAAAAAAGATACAGGGGAAGACTGGAGGGCG
TCTGAAACACAGCTGTTCTACCTTTAGAGCATTGAAAATTGATGCTTTACTGCCTTGGGG
ATTTGTTACCACCTTACTGGAAATACTACTGGGAAAAGTTATTATAATATAANAGCTCTT
GGCCCTGCTGTTTATAAACAACAGAAAACAAATTA
Restriction Sites NotI-NotI |
ACCN NM_006049
Insert Size 3870 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_006049.1, NP_006040.1
RefSeq Size 297 bp
RefSeq ORF 297 bp
Locus ID 10302
UniProt ID O75971
Cytogenetics 15q22.31
Protein Families Transcription Factors
Summary This gene encodes a subunit of the small nuclear RNA (snRNA)-activating protein complex that plays a role in the transcription of snRNA genes. This complex binds to the promoters of snRNA genes transcribed by either RNA polymerase II or III and recruits other regulatory factors to activate snRNA gene transcription. The encoded protein may play a role in stabilizing this complex. A pseudogene of this gene has been identified on chromosome 6. provided by RefSeq, Jul 2016
Transcript Variant: This variant (1) encodes the longest isoform (1). Both variants 1 and 4 encode the same isoform (1).
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_006049" in other vectors (4)
SKU Description Size Price
RC219992 SNAPC5 (Myc-DDK-tagged)-Human small nuclear RNA activating complex, polypeptide 5, 19kDa (SNAPC5) 10 ug
$150.00
RC219992L3 Lenti ORF clone of Human small nuclear RNA activating complex, polypeptide 5, 19kDa (SNAPC5), Myc-DDK-tagged 10 ug
$450.00
RC219992L4 Lenti ORF clone of Human small nuclear RNA activating complex, polypeptide 5, 19kDa (SNAPC5), mGFP tagged 10 ug
$450.00
RG219992 SNAPC5 (tGFP-tagged) - Human small nuclear RNA activating complex, polypeptide 5, 19kDa (SNAPC5) 10 ug
$350.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products