OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

PDZD11 (NM_016484) Human Untagged Clone

Be the first to review this product
SKU
SC114246
PDZD11 (untagged)-Human PDZ domain containing 11 (PDZD11)
  $150.00
2 Weeks*
Bulk Requests & Clone Modifications

Frequently Bought Together (4)

TA331912 Rabbit Polyclonal Anti-PDZD11 Antibody
100 ul
$585.00
CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "PDZD11 or NM_016484"

Specifications
Specifications
Product Data
Type Human Untagged Clone
Target Symbol PDZD11
Synonyms AIPP1; PDZK11; PISP
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
Fully Sequenced ORF
>OriGene ORF sequence for NM_016484 edited
TCGCTGTGGACTGCCCACTGGGCCTTGCCCGAGATGGACAGCCGGATTCCTTATGATGAC
TACCCGGTGGTTTTCTTGCCTGCCTATGAGAATCCTCCAGCATGGATTCCTCCTCATGAG
AGGGTACACCACCCGGACTACAACAATGAGTTGACCCAGTTTCTGCCCCGAACCATCACA
CTGAAGAAGCCTCCTGGAGCTCAGTTGGGATTTAACATCCGAGGAGGAAAGGCCTCCCAG
CTAGGCATCTTCATCTCCAAGGTGATTCCTGACTCTGATGCACATAGAGCAGGACTGCAG
GAAGGGGACCAAGTTCTAGCTGTGAATGATGTGGATTTCCAAGATATTGAGCACAGCAAG
GCTGTTGAGATCCTGAAGACAGCTCGTGAAATCAGCATGCGTGTGCGCTTCTTTCCCTAC
AATTATCATCGCCAAAAAGAGAGGACTGTGCACTAGAAAGTTGCAGCCCACAGCCCTTCA
TGTGGACTCTGTCATGACATGCTAACTAGACTTCAGGGGAGCCACTTCTGTTTTCAGCCC
CTCCCTGGAATAGTGAGTTGGGAGGATGGGGAGACAGCTAACCAACTGCATTACCCAAAC
CATATTGCACTTTTAGTTCCCTAGTTTTCTAGGTGAGCTTCATTCCCTGAAAGGAGGATG
ATGATATCTAGGCATAACCTAGCCTGTGAGGAACCTAGTTAGGAAAGACAACTGACATTT
ATTGAATATCATGCACTAGTCCCTTACATATGTCATATTTTAATTATAGAAATCAGTAGC
AAAAAGAATCTTGGGGATTTTCCATCTGACTTCCCTGGCCATCTTATCCCATCCTTGCAC
TACCAGAAGATTCATACACTTTTGAGACTCCAGTGAGACGCTGTTTTCACCCCTTCCTCC
TCCTAGCCTCTCTCCCAAAAAGTAAAACACAATGCTGAAGAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAA
Restriction Sites NotI-NotI |
ACCN NM_016484
Insert Size 1000 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation The ORF of this clone has been fully sequenced and found to be a perfect match to NM_016484.3.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_016484.3, NP_057568.1
RefSeq Size 1731 bp
RefSeq ORF 423 bp
Locus ID 51248
UniProt ID Q5EBL8
Cytogenetics Xq13.1
Domains PDZ
Protein Families Secreted Protein
Summary Mediates docking of ADAM10 to zonula adherens by interacting with PLEKHA7 which is required for PLEKHA7 to interact with the ADAM10-binding protein TSPAN33.UniProtKB/Swiss-Prot Function
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_016484" in other vectors (4)
SKU Description Size Price
RC201049 PDZD11 (Myc-DDK-tagged)-Human PDZ domain containing 11 (PDZD11) 10 ug
$150.00
RC201049L3 Lenti ORF clone of Human PDZ domain containing 11 (PDZD11), Myc-DDK-tagged 10 ug
$450.00
RC201049L4 Lenti ORF clone of Human PDZ domain containing 11 (PDZD11), mGFP tagged 10 ug
$450.00
RG201049 PDZD11 (tGFP-tagged) - Human PDZ domain containing 11 (PDZD11) 10 ug
$489.00

file-alt Citations

Association of PDZ-containing protein PDZD11 with the human sodium-dependent multivitamin transporter
Nabokina, Subramanian, Said
Am. J. Physiol. Gastrointest. Liver Physiol. (2011) 300 (4), G561-7 DOI: 10.1152/ajpgi.00530.2010
Cited by 24
AI Summary: OriGene's human PDZD11 cDNA was used to generate the GST-PDZD11 fusion protein, which enabled the authors to confirm the interaction between PDZD11 and the sodium-dependent multivitamin transporter (hSMVT) through GST pull-down assays.
Snippet: reading frame of human PDZD11 (OriGene, Rockville, MD) was inserted in frame into BamHI/ XhoI sites of pGEX-4T-1 vector (Invitrogen, Carlsbad, CA). GST-PDZD11 fusion protein and GST were produced in BL-21 Escherichia coli cells and used in GST pull-down assay as
Showing 1-1 of 1 papers.
Powered by BizGenius
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products