OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

CD3G (NM_000073) Human Untagged Clone

Be the first to review this product
SKU
SC112775
CD3G (untagged)-Human CD3g molecule, gamma (CD3-TCR complex) (CD3G)
  $300.00
In Stock*
Bulk Requests & Clone Modifications

Frequently Bought Together (4)

TA383935 CD3G Rabbit monoclonal Antibody
100 ul
$380.00
CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "CD3G or NM_000073"

Specifications
Specifications
Product Data
Type Human Untagged Clone
Target Symbol CD3G
Synonyms CD3-GAMMA; IMD17; T3G
Vector pCMV6-XL4
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
Fully Sequenced ORF
>OriGene ORF within SC112775 sequence for NM_000073 edited (data generated by NextGen Sequencing)
ATGGAACAGGGGAAGGGCCTGGCTGTCCTCATCCTGGCTATCATTCTTCTTCAAGGTACT
TTGGCCCAGTCAATCAAAGGAAACCACTTGGTTAAGGTGTATGACTATCAAGAAGATGGT
TCGGTACTTCTGACTTGTGATGCAGAAGCCAAAAATATCACATGGTTTAAAGATGGGAAG
ATGATCGGCTTCCTAACTGAAGATAAAAAAAAATGGAATCTGGGAAGTAATGCCAAGGAC
CCTCGAGGGATGTATCAGTGTAAAGGATCACAGAACAAGTCAAAACCACTCCAAGTGTAT
TACAGAATGTGTCAGAACTGCATTGAACTAAATGCAGCCACCATATCTGGCTTTCTCTTT
GCTGAAATCGTCAGCATTTTCGTCCTTGCTGTTGGGGTCTACTTCATTGCTGGACAGGAT
GGAGTTCGCCAGTCGAGAGCTTCAGACAAGCAGACTCTGTTGCCCAATGACCAGCTCTAC
CAGCCCCTCAAGGATCGAGAAGATGACCAGTACAGCCACCTTCAAGGAAACCAGTTGAGG
AGGAATTGA

Clone variation with respect to NM_000073.2
5' Read Nucleotide Sequence
>OriGene 5' read for NM_000073 unedited
NGGTTCGGGATTAGTATCCGATTCATNATAGGGCGGCCGCGAATTCGGCACCAGGGCTGC
TAAGGGCTGCTCCACGCTTTTGCNCGGAGACAGAGACTGACATGGAACAGGGGAAGGGCC
TGGCTGTCCTCATCCTGGCTATCATTCTTCTTCAAGTACTTTGGCCCAGTCAATCAAAGG
AAACCACTTGGTTAAGGTGTATGACTATCAAGAAGATGGTTCGGTACTTCTGACTTGTGA
TGCAGAAGCCAAAAATATCACATGGTTTAAAGATGGGAAGATGATCGGCTTCCTAACTGA
AGATAAAAAAAAATGGAATCTGGGAAGTAATGCCAAGGACCCTCGAGGGATGTATCAGTG
TAAAGGATCACAGAACAAGTCAAAACCACTCCAAGTGTATTACAGAATGTGTCAGAACTG
CATTGAACTAAATGCAGCCACCATATCTGGCTTTCTCTTTGCTGAAATCGTCAGCATTTT
CGTCCTTGCTGTTGGGGTCTACTTCATTGCTGGACAGGATGGAGTTCGCCAGTCGAGAGC
TTCAGACAAGCAGACTCTGTTGCCCAATGACCAGCTCTACCAGCCCCTCAAGGATCGAGA
AGATGACCAGTACAGCCACCTTCAAGGAAACCAGTTGAGGAGGAATTGAACTCAGGACTC
AGAGTAGTCCAGGTGTTCTCCTCCTATTCAGTTCCCAGAATCAAAAGCATGCATTTTGGA
AAGCTCCTAGCAGAGAGACTTTCAGCCCTAAATCTAGACTCAAGGTTCCCAGAGATGACA
AATGGAGAAGAAAGGCCATCAGAGCAAATTTGGGGTTTCTCAAATAATAAAATAAAACCA
ATCCTGTGTTTCAGAAGCGCACCTATTGNGGAAAATGTNNAAGAAAATGAAAGTTCCATA
ACCCCCTGAAT
Restriction Sites NotI-NotI |
ACCN NM_000073
Insert Size 3000 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_000073.1, NP_000064.1
RefSeq Size 822 bp
RefSeq ORF 549 bp
Locus ID 917
UniProt ID P09693
Cytogenetics 11q23.3
Domains IGc2, ITAM
Protein Families Druggable Genome, Transmembrane
Protein Pathways Hematopoietic cell lineage, T cell receptor signaling pathway
Summary The protein encoded by this gene is the CD3-gamma polypeptide, which together with CD3-epsilon, -delta and -zeta, and the T-cell receptor alpha/beta and gamma/delta heterodimers, forms the T-cell receptor-CD3 complex. This complex plays an important role in coupling antigen recognition to several intracellular signal-transduction pathways. The genes encoding the epsilon, gamma and delta polypeptides are located in the same cluster on chromosome 11. Defects in this gene are associated with T cell immunodeficiency. provided by RefSeq, Jul 2008
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_000073" in other vectors (6)
SKU Description Size Price
RC220512 CD3G (Myc-DDK-tagged)-Human CD3g molecule, gamma (CD3-TCR complex) (CD3G) 10 ug
$300.00
RC220512L1 Lenti ORF clone of Human CD3g molecule, gamma (CD3-TCR complex) (CD3G), Myc-DDK-tagged 10 ug
$600.00
RC220512L2 Lenti ORF clone of Human CD3g molecule, gamma (CD3-TCR complex) (CD3G), mGFP tagged 10 ug
$600.00
RC220512L3 Lenti ORF clone of Human CD3g molecule, gamma (CD3-TCR complex) (CD3G), Myc-DDK-tagged 10 ug
$600.00
RC220512L4 Lenti ORF clone of Human CD3g molecule, gamma (CD3-TCR complex) (CD3G), mGFP tagged 10 ug
$600.00
RG220512 CD3G (tGFP-tagged) - Human CD3g molecule, gamma (CD3-TCR complex) (CD3G) 10 ug
$489.00 $500.00

file-alt Citations

Retroviral vectors for homologous recombination provide efficient cloning and expression in mammalian cells
Kobayashi, Kishi, Ozawa et al
Biochem. Biophys. Res. Commun. (2014)
Cited by 2
AI Summary: OriGene contributed to this study by providing human CD3γ, CD3δ, CD3ε, ζ, and CD8 cDNA products, which were essential for constructing expression vectors used in the cloning and functional analysis of T-cell receptors in mammalian cells.
Snippet: CD8 cDNAs were constructed by linking these cDNAs with the 2A sequence from the foot-and-mouth disease virus, as previously described (2A-hCD3-hCD8 vector) [14]. All human CD3γ, CD3δ, CD3ε, ζ and CD8 cDNAs were purchased from Origene
Showing 1-1 of 1 papers.
Powered by BizGenius
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products