OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

TPST2 (NM_003595) Human Untagged Clone

Be the first to review this product
SKU
SC112732
TPST2 (untagged)-Human tyrosylprotein sulfotransferase 2 (TPST2), transcript variant 2
  $457.00
In Stock*
Bulk Requests & Clone Modifications

Frequently Bought Together (4)

TA351844 Rabbit Polyclonal Anti-TPST2 Antibody
100 ul
$205.00
CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "TPST2 or NM_003595"

Specifications
Specifications
Product Data
Type Human Untagged Clone
Target Symbol TPST2
Synonyms TANGO13B; TPST-2
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC112732 representing NM_003595.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGCGCCTGTCGGTGCGGAGGGTGCTGCTGGCAGCCGGCTGCGCCCTGGTCCTGGTGCTGGCGGTTCAG
CTGGGACAGCAGGTGCTAGAGTGCCGGGCGGTGCTGGCGGGCCTGCGGAGCCCCCGGGGGGCCATGCGG
CCTGAGCAGGAGGAGCTGGTGATGGTGGGCACCAACCACGTGGAATACCGCTATGGCAAGGCCATGCCG
CTCATCTTCGTGGGTGGCGTGCCTCGCAGTGGCACCACGTTGATGCGCGCCATGCTGGACGCGCACCCC
GAGGTGCGCTGCGGCGAGGAGACCCGCATCATCCCGCGCGTGCTGGCCATGCGCCAGGCCTGGTCCAAG
TCTGGCCGTGAGAAGCTGCGGCTGGATGAGGCGGGGGTGACGGATGAGGTGCTGGACGCCGCCATGCAG
GCCTTCATCCTGGAGGTGATTGCCAAGCACGGAGAGCCGGCCCGCGTGCTCTGCAACAAGGACCCATTT
ACGCTCAAGTCCTCGGTCTACCTGTCGCGCCTGTTCCCCAACTCCAAGTTCCTGCTGATGGTGCGGGAC
GGCCGGGCCTCCGTGCACTCCATGATCACGCGCAAAGTCACCATTGCGGGCTTTGACCTCAGCAGCTAC
CGTGACTGCCTCACCAAGTGGAACAAGGCCATCGAGGTGATGTACGCCCAGTGCATGGAGGTAGGCAAG
GAGAAGTGCCTGCCTGTGTACTACGAGCAGCTGGTGCTGCACCCCAGGCGCTCACTCAAGCTCATCCTC
GACTTCCTCGGCATCGCCTGGAGCGACGCTGTCCTCCACCATGAAGACCTCATTGGCAAGCCCGGTGGT
GTCTCCCTGTCCAAGATCGAGCGGTCCACGGACCAGGTCATCAAGCCTGTTAACCTGGAAGCGCTCTCC
AAGTGGACTGGCCACATCCCTGGGGATGTGGTGCGGGACATGGCCCAGATCGCCCCCATGCTGGCTCAG
CTCGGCTATGACCCTTATGCAAACCCCCCCAACTATGGCAACCCTGACCCCTTCGTCATCAACAACACA
CAGCGGGTCTTGAAAGGGGACTATAAAACACCAGCCAATCTGAAAGGATATTTTCAGGTGAACCAGAAC
AGCACCTCCTCCCACTTAGGAAGCTCGTGA
ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
Chromatograms Chromatograms
Sequencher program is needed, download here
Restriction Sites SgfI-MluI |
ACCN NM_003595
Insert Size 1134 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_003595.3
RefSeq Size 1910 bp
RefSeq ORF 1134 bp
Locus ID 8459
UniProt ID O60704
Cytogenetics 22q12.1
Domains Sulfotransfer
Protein Families Transmembrane
MW 41.9 kDa
Summary The protein encoded by this gene catalyzes the O-sulfation of tyrosine residues within acidic regions of proteins. The encoded protein is a type II integral membrane protein found in the Golgi body. Alternative splicing produces multiple transcript variants encoding distinct isoforms. provided by RefSeq, May 2018
Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. Variants 1 and 2 both encode the same protein.
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_003595" in other vectors (6)
SKU Description Size Price
RC220456 TPST2 (Myc-DDK-tagged)-Human tyrosylprotein sulfotransferase 2 (TPST2), transcript variant 2 10 ug
$457.00
RC220456L1 Lenti ORF clone of Human tyrosylprotein sulfotransferase 2 (TPST2), transcript variant 2, Myc-DDK-tagged 10 ug
$757.00
RC220456L2 Lenti ORF clone of Human tyrosylprotein sulfotransferase 2 (TPST2), transcript variant 2, mGFP tagged 10 ug
$757.00
RC220456L3 Lenti ORF clone of Human tyrosylprotein sulfotransferase 2 (TPST2), transcript variant 2, Myc-DDK-tagged 10 ug
$757.00
RC220456L4 Lenti ORF clone of Human tyrosylprotein sulfotransferase 2 (TPST2), transcript variant 2, mGFP tagged 10 ug
$757.00
RG220456 TPST2 (tGFP-tagged) - Human tyrosylprotein sulfotransferase 2 (TPST2), transcript variant 2 10 ug
$489.00 $657.00

file-alt Citations

Fluorescent peptide sensors for tyrosylprotein sulfotransferase activity
Zhou, Duckworth, Geraghty
Anal. Biochem. (2014) 461C, 1-6 DOI: 10.1016/j.ab.2014.05.025
Cited by 12
AI Summary: OriGene contributed to this study by providing the cDNAs for the human tyrosylprotein sulfotransferases (hTPST1 and hTPST2), which were essential for expressing and studying the enzymes' activity in the fluorescent peptide-based assay.
Snippet: Materials. All peptides were synthesized by PEPTIDE 2.0 except PSGL-1 peptide (sequence: Biotin-RDRRQATEYEYLDYDFLPETEPPP) that was synthesized by the University of Minnesota Genomics Center. The cDNAs for the hTPSTs were purchased from Origene ... Related articles Cite SaveSaving
Showing 1-1 of 1 papers.
Powered by BizGenius
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products