OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

PKIB (NM_181795) Human Untagged Clone

Be the first to review this product
SKU
SC109615
PKIB (untagged)-Human protein kinase (cAMP-dependent, catalytic) inhibitor beta (PKIB), transcript variant 1
  $150.00
In Stock*
Bulk Requests & Clone Modifications

Frequently Bought Together (4)

TA314384 Rabbit polyclonal anti-IPKB antibody
100 ul
$380.00
CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "PKIB or NM_181795"

Specifications
Specifications
Product Data
Type Human Untagged Clone
Target Symbol PKIB
Synonyms PRKACN2
Vector pCMV6-XL4
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
Fully Sequenced ORF
>OriGene ORF sequence for NM_181795 edited
ATGAGGACAGATTCATCAAAAATGACTGACGTGGAGTCTGGGGTCGCCAATTTTGCATCT
TCAGCAAGGGCAGGCCGCCGGAATGCCTTACCAGACATCCAGAGTTCAGCTGCCACAGAC
GGAACCTCAGATTTGCCCCTCAAACTGGAGGCTCTCTCCGTGAAGGAAGATGCAAAAGAG
AAAGATGAAAAAACAACACAAGACCAATTGGAAAAGCCTCAAAATGAAGAAAAATGA
5' Read Nucleotide Sequence
>OriGene 5' read for NM_181795 unedited
NCGTTCACAATTGTAAACGACTCCTATAGGCGGCCGCGNAATTCGCACGAGGTGGACTGT
AGAGGCGGCAGCGAGCTAGAGCCCGAGTCGCAGCTCCGGGCCGCAGAGCGCTGGGCGAGC
GCGAGCGCCAGGGCACCGGCAGGGCAGGCAGCTGCGCGCGGCTGGAGTCATGCTATACTG
AAAAGACACTTCATCAAGATAACTCTGGGAGAAGCAGAAAACCCTGTGCCAGGGACAGGA
AAGATAGGAGAAAGAAAGTTTATCAGAATTTTTTAAACCTGTCTCAGAAATAACAACATA
TTTTAATCAGAGATTTATGTTGCTATGAGGACAGATTCATCAAAAATGACTGACGTGGAG
TCTGGGGTCGCCAATTTTGCATCTTCAGCAAGGGCAGGCCGCCGGAATGCCTTACCAGAC
ATCCAGAGTTCAGCTGCCACAGACGGAACCTCAGATTTGCCCCTCAAACTGGAGGCTCTC
TCCGTGAAGGAAGATGCAAAAGAGAAAGATGAAAAAACAACACAAGACCAATTGGAAAAG
CCTCAAAATGAAGAAAAATGAAGGCTCATAATCTATCAAGAGTGCTGAATTTCTGCATGT
TGAAAGACTTAGTGGTTCTGTTTTCTTGAGACATTTAATCTGGTGGTAACTGTGGTAACA
TTGCAGCCCTAAGCAGCATGTGTATATTAGATAATTGTCTCAAGAAAACCCAACTCCCCG
AACCACTCAGGNTCCTGTGGACAGCTCACCTAGTGGCAATGGCTCCCAGCTCCCCGGACG
TCCCTGCTCCTGGGCTTTGCCCTGCTCTGCCTGCCCTGGCTTCAGAAGCTGNTGCCCGCC
AAACGNTNNCGTATCCNAGCTNTNTGACCCGCTATGCTNCAAGCCATCGCGCGCACAGCT
GGCCATTGACACTACCCAGAGTTGAAGAAC
Restriction Sites NotI-NotI |
ACCN NM_181795
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_181795.1, NP_861460.1
RefSeq Size 1909 bp
RefSeq ORF 237 bp
Locus ID 5570
UniProt ID Q9C010
Cytogenetics 6q22.31
Protein Families Druggable Genome
Summary This gene encodes a member of the cAMP-dependent protein kinase inhibitor family. The encoded protein may play a role in the protein kinase A (PKA) pathway by interacting with the catalytic subunit of PKA, and overexpression of this gene may play a role in prostate cancer. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. provided by RefSeq, Jul 2012
Transcript Variant: This variant (1) encodes the shorter isoform (1). Variants 1, 2, 3 and 4 encode the same isoform. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_181795" in other vectors (6)
SKU Description Size Price
RC212372 PKIB (Myc-DDK-tagged)-Human protein kinase (cAMP-dependent, catalytic) inhibitor beta (PKIB), transcript variant 1 10 ug
$150.00
RC212372L1 Lenti ORF clone of Human protein kinase (cAMP-dependent, catalytic) inhibitor beta (PKIB), transcript variant 1, Myc-DDK-tagged 10 ug
$450.00
RC212372L2 Lenti ORF clone of Human protein kinase (cAMP-dependent, catalytic) inhibitor beta (PKIB), transcript variant 1, mGFP tagged 10 ug
$450.00
RC212372L3 Lenti ORF clone of Human protein kinase (cAMP-dependent, catalytic) inhibitor beta (PKIB), transcript variant 1, Myc-DDK-tagged 10 ug
$450.00
RC212372L4 Lenti ORF clone of Human protein kinase (cAMP-dependent, catalytic) inhibitor beta (PKIB), transcript variant 1, mGFP tagged 10 ug
$450.00
RG212372 PKIB (tGFP-tagged) - Human protein kinase (cAMP-dependent, catalytic) inhibitor beta (PKIB), transcript variant 1 10 ug
$489.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products