OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

MAX (NM_145116) Human Untagged Clone

Be the first to review this product
SKU
SC109407
MAX (untagged)-Human MYC associated factor X (MAX), transcript variant 5
  $150.00
In Stock*
Bulk Requests & Clone Modifications

Frequently Bought Together (4)

TA815026 MAX mouse monoclonal antibody,clone OTI14G1 100 ul
$447.00
CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "MAX or NM_145116"

Specifications
Specifications
Product Data
Type Human Untagged Clone
Target Symbol MAX
Synonyms bHLHd4; bHLHd5; bHLHd6; bHLHd7; bHLHd8; orf1
Vector pCMV6-XL4
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
Fully Sequenced ORF
>NCBI ORF sequence for NM_145116, the custom clone sequence may differ by one or more nucleotides


ATGAGCGATAACGATGACATCGAGGTGGAGAGCGACGAAGAGCAACCGAGGTTTCAATCTGCGGCTGACA
AACGGGCTCATCATAATGCACTGGAACGAAAACGTAGGGACCACATCAAAGACAGCTTTCACAGTTTGCG
GGACTCAGTCCCATCACTCCAAGGAGAGAAGGCATCCCGGGCCCAAATCCTAGACAAAGCCACAGAATAT
ATCCAGTATATGCGAAGGAAAAACCACACACACCAGCAAGATATTGACGACCTCAAGCGGCAGAATGCTC
TTCTGGAGCAGCAAGGTGAGCACCCGAGCTCGTGGGGCAGCTGGCCCTGCTGTGCTCCAGCCAGGTCAGG
CTTTGGCACCTGGGCCTGCAGAGTCAGAGCCAGTCATGGAGTATGTGCTCAGTAG

5' Read Nucleotide Sequence
>OriGene 5' read for NM_145116 unedited
GGGTGCCCATTTGTATACGACTCACTATAGGCGGCCCGCGATTCGGCACGAGGGTTCTTG
CCCGTGTTGTGTGTGTGTGTGAGTGAGAGAGCGAGTGAGTGAGTGAGTGAGTGTGTGTGT
GGGGGGGACTCGGCTTGTTGTTGTCGGTGACTTCCCCCTCCCCTTCACCCCTTCCCCTCC
CCGCCGCCGCTGCAGTGGCCGCTCCCTGGGCCGTAGGAAATGAGCGATAACGATGACATC
GAGGTGGAGAGCGACGAAGAGCAACCGAGGTTTCAATCTGCGGCTGACAAACGGGCTCAT
CATAATGCACTGGAACGAAAACGTAGGGACCACATCAAAGACAGCTTTCACAGTTTGCGG
GACTCAGTCCCATCACTCCAAGGAGAGAAGGCATCCCGGGCCCAAATCCTAGACAAAGCC
ACAGAATATATCCAGTATATGCGAAGGAAAAACCACACACACCAGCAAGATATTGACGAC
CTCAAGCGGCAGAATGCTCTTCTGGAGCAGCAAGGTGAGCACCCGAGCTCGTGGGGCAGC
TGGCCCTGCTGTGCTCCAGCCAGGTCAGGCTTTGGCACCTGGGCCTGCAGAGTCAGAGCC
AGTCATGGAGTATGTGCTCAGTAGCAGGCTTGGTCCTGCTTCTTNGGGCCTGAGTAACTG
AGTGTTAGAGCCGTCCTGNAGAANGACCTTGAGCGCCAGTGANGAGACAGTGGGAGCTAA
GAAGTTGGACATCTGGAGACTGTATCTTTTTCTGCCTGACCTCTCCCCTTCTGGGGCTCA
AGTGCTCTGCCTGCAGTAGGGATCACACCTTGCATCAAGTGTCTGAAAAGACCTTTGAGG
TCCTTGGAGTGAATGTGCTGTGTAAGTCCCGAGACTTCAGGTGTTCAGGGACAGTGAGCC
CTCCCCATTGGCATGTAATC
Restriction Sites NotI-NotI |
ACCN NM_145116
Insert Size 3400 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_145116.1, NP_660092.1
RefSeq Size 575 bp
RefSeq ORF 405 bp
Locus ID 4149
Cytogenetics 14q23.3
Domains HLH
Protein Families Druggable Genome, Transcription Factors
Protein Pathways MAPK signaling pathway, Pathways in cancer, Small cell lung cancer
Summary The protein encoded by this gene is a member of the basic helix-loop-helix leucine zipper (bHLHZ) family of transcription factors. It is able to form homodimers and heterodimers with other family members, which include Mad, Mxi1 and Myc. Myc is an oncoprotein implicated in cell proliferation, differentiation and apoptosis. The homodimers and heterodimers compete for a common DNA target site (the E box) and rearrangement among these dimer forms provides a complex system of transcriptional regulation. Mutations of this gene have been reported to be associated with hereditary pheochromocytoma. A pseudogene of this gene is located on the long arm of chromosome 7. Alternative splicing results in multiple transcript variants. provided by RefSeq, Aug 2012
Transcript Variant: This variant (5) uses an alternate splice site in the 3' coding region and lacks a downstream exon, compared to variant 1. The resulting protein (isoform e) has a distinct C-terminus, compared to isoform a.
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_145116" in other vectors (4)
SKU Description Size Price
RC206294 MAX (Myc-DDK-tagged)-Human MYC associated factor X (MAX), transcript variant 5 10 ug
$150.00
RC206294L3 Lenti ORF clone of Human MYC associated factor X (MAX), transcript variant 5, Myc-DDK-tagged 10 ug
$450.00
RC206294L4 Lenti ORF clone of Human MYC associated factor X (MAX), transcript variant 5, mGFP tagged 10 ug
$450.00
RG206294 MAX (tGFP-tagged) - Human MYC associated factor X (MAX), transcript variant 5 10 ug
$489.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products