OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

ING1 (NM_198218) Human Untagged Clone

Be the first to review this product
SKU
SC109351
ING1 (untagged)-Human inhibitor of growth family, member 1 (ING1), transcript variant 2
  $300.00
In Stock*
Bulk Requests & Clone Modifications

Frequently Bought Together (4)

TA590316 Rabbit Polyclonal ING1 Antibody
100 ug
$482.00
CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "ING1 or NM_198218"

Specifications
Specifications
Product Data
Type Human Untagged Clone
Target Symbol ING1
Synonyms p24ING1c; p33; p33ING1; p33ING1b; p47; p47ING1a
Vector pCMV6-XL4
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
Fully Sequenced ORF
>NCBI ORF sequence for NM_198218, the custom clone sequence may differ by one or more nucleotides


ATGCTGCACTGTGTGCAGCGCGCGCTGATCCGCAGCCAGGAGCTGGGCGACGAGAAGATCCAGATCGTGA
GCCAGATGGTGGAGCTGGTGGAGAACCGCACGCGGCAGGTGGACAGCCACGTGGAGCTGTTCGAGGCGCA
GCAGGAGCTGGGCGACACAGCGGGCAACAGCGGCAAGGCTGGCGCGGACAGGCCCAAAGGCGAGGCGGCA
GCGCAGGCTGACAAGCCCAACAGCAAGCGCTCACGGCGGCAGCGCAACAACGAGAACCGTGAGAACGCGT
CCAGCAACCACGACCACGACGACGGCGCCTCGGGCACACCCAAGGAGAAGAAGGCCAAGACCTCCAAGAA
GAAGAAGCGCTCCAAGGCCAAGGCGGAGCGAGAGGCGTCCCCTGCCGACCTCCCCATCGACCCCAACGAA
CCCACGTACTGTCTGTGCAACCAGGTCTCCTATGGGGAGATGATCGGCTGCGACAACGACGAGTGCCCCA
TCGAGTGGTTCCACTTCTCGTGCGTGGGGCTCAATCATAAACCCAAGGGCAAGTGGTACTGTCCCAAGTG
CCGGGGGGAGAACGAGAAGACCATGGACAAAGCCCTGGAGAAATCCAAAAAAGAGAGGGCTTACAACAGG
TAG

5' Read Nucleotide Sequence
>OriGene 5' read for NM_198218 unedited
GTCAGATTTTGTAATACGACTTCACTATAGGGCGGCCGCGATTCGGCACCAGGTCCTGCC
AACGGGGAGCAGCTCCACCTGGTGAACTATGTGGAGGACTACCTGGACTCCATCGAGTCC
CTGCCTTTCGACTTGCAGAGAAATGTCTCGCTGATGCGGGAGATCGACGCGAAATACCAA
GAGATCCTGAAGGAGCTAGACGAGTGCTACGAGCGCTTCAGTCGCGAGACAGACGGGGCG
CAGAAGCGGCGGATGCTGCACTGTGTGCAGCGCGCGCTGATCCGCAGCCAGGAGCTGGGC
GACGAGAAGATCCAGATCGTGAGCCAGATGGTGGAGCTGGTGGAGAACCGCACGCGGCAG
GTGGACAGCCACGTGGAGCTGTTCGAGGCGCAGCAGGAGCTGGGCGACACAGCGGGCAAC
AGCGGCAAGGCTGGCGCGGACAGGCCCAAAGGCGAGGCGGCAGCGCAGGCTGACAAGCCC
AACAGCAAGCGCTCACGGCGGCAGCGCAACAACGAGAACCGTGAGAACGCGTCCAGCAAC
CACGACCACGACGACGGCGCCTCGGGCACACCCAAGGAGAAGAAGGCCAAGACCTCCAAG
AAGAAGAAGCGCTCCAAGGCCAAGGCGGAGCGAGAGGCGTCCCCTGCCGACCTCCCCATC
GACCCCAACGAACCCACGTACTGTCTGTGCAACCAGGTCTCCTATGGGGAGATGATCGGC
TGCGACACGACGAGTGCCCCATCGAGTGGTTCCACTTCTCGTGCGTGGGGCTCAATCATA
NACCCAAGGGCAGTGGTACTGTCCCAAGTGCCGGNGGGGAGACGAGAAGACCTGTACAAA
GCCCTGGAAANTCCANAAAGAGAGGGCTACACAGGGTAGTTGTGACAGCGCCTGGTGTGA
GGAGACAAATAAACCGTGTATTATACATGCTGCCTTGNTGAGTGCAGGAGGTAAAATATT
Restriction Sites NotI-NotI |
ACCN NM_198218
Insert Size 4700 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_198218.1, NP_937861.1
RefSeq Size 2213 bp
RefSeq ORF 633 bp
Locus ID 3621
UniProt ID Q9UK53
Cytogenetics 13q34
Protein Families Druggable Genome, Transcription Factors
Summary This gene encodes a tumor suppressor protein that can induce cell growth arrest and apoptosis. The encoded protein is a nuclear protein that physically interacts with the tumor suppressor protein TP53 and is a component of the p53 signaling pathway. Reduced expression and rearrangement of this gene have been detected in various cancers. Multiple alternatively spliced transcript variants encoding distinct isoforms have been reported. provided by RefSeq, Jul 2008
Transcript Variant: This variant (2) differs in the 5' end-region and uses a downstream in-frame start codon, compared to variant 4. The resulting isoform (B) has a shorter N-terminus, as compared to isoform D.
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_198218" in other vectors (4)
SKU Description Size Price
RC210888 ING1 (Myc-DDK-tagged)-Human inhibitor of growth family, member 1 (ING1), transcript variant 2 10 ug
$300.00
RC210888L3 Lenti ORF clone of Human inhibitor of growth family, member 1 (ING1), transcript variant 2, Myc-DDK-tagged 10 ug
$600.00
RC210888L4 Lenti ORF clone of Human inhibitor of growth family, member 1 (ING1), transcript variant 2, mGFP tagged 10 ug
$600.00
RG210888 ING1 (tGFP-tagged) - Human inhibitor of growth family, member 1 (ING1), transcript variant 2 10 ug
$489.00 $500.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products