OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

GRP78 (HSPA5) (NM_005347) Human Untagged Clone

Be the first to review this product
SKU
SC108086
HSPA5 (untagged)-Human heat shock 70kDa protein 5 (glucose-regulated protein, 78kDa) (HSPA5)
  $610.00
In Stock*
Bulk Requests & Clone Modifications

Frequently Bought Together (4)

TA312902 Rabbit polyclonal anti-GRP78 / HSPA5 antibody
100 ul
$380.00
CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "GRP78 or NM_005347"

Specifications
Specifications
Product Data
Type Human Untagged Clone
Target Symbol GRP78
Synonyms BIP; GRP78; HEL-S-89n
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
Fully Sequenced ORF
>OriGene ORF within SC108086 sequence for NM_005347 edited (data generated by NextGen Sequencing)
ATGAAGCTCTCCCTGGTGGCCGCGATGCTGCTGCTGCTCAGCGCGGCGCGGGCCGAGGAG
GAGGACAAGAAGGAGGACGTGGGCACGGTGGTCGGCATCGACCTGGGGACCACCTACTCC
TGCGTCGGCGTGTTCAAGAACGGCCGCGTGGAGATCATCGCCAACGATCAGGGCAACCGC
ATCACGCCGTCCTATGTCGCCTTCACTCCTGAAGGGGAACGTCTGATTGGCGATGCCGCC
AAGAACCAGCTCACCTCCAACCCCGAGAACACGGTCTTTGACGCCAAGCGGCTCATCGGC
CGCACGTGGAATGACCCGTCTGTGCAGCAGGACATCAAGTTCTTGCCGTTCAAGGTGGTT
GAAAAGAAAACTAAACCATACATTCAAGTTGATATTGGAGGTGGGCAAACAAAGACATTT
GCTCCTGAAGAAATTTCTGCCATGGTTCTCACTAAAATGAAAGAAACCGCTGAGGCTTAT
TTGGGAAAGAAGGTTACCCATGCAGTTGTTACTGTACCAGCCTATTTTAATGATGCCCAA
CGCCAAGCAACCAAAGACGCTGGAACTATTGCTGGCCTAAATGTTATGAGGATCATCAAC
GAGCCTACGGCAGCTGCTATTGCTTATGGCCTGGATAAGAGGGAGGGGGAGAAGAACATC
CTGGTGTTTGACCTGGGTGGCGGAACCTTCGATGTGTCTCTTCTCACCATTGACAATGGT
GTCTTCGAAGTTGTGGCCACTAATGGAGATACTCATCTGGGTGGAGAAGACTTTGACCAG
CGTGTCATGGAACACTTCATCAAACTGTACAAAAAGAAGACGGGCAAAGATGTCAGGAAA
GACAATAGAGCTGTGCAGAAACTCCGGCGCGAGGTAGAAAAGGCCAAACGGGCCCTGTCT
TCTCAGCATCAAGCAAGAATTGAAATTGAGTCCTTCTATGAAGGAGAAGACTTTTCTGAG
ACCCTGACTCGGGCCAAATTTGAAGAGCTCAACATGGATCTGTTCCGGTCTACTATGAAG
CCCGTCCAGAAAGTGTTGGAAGATTCTGATTTGAAGAAGTCTGATATTGATGAAATTGTT
CTTGTTGGTGGCTCGACTCGAATTCCAAAGATTCAGCAACTGGTTAAAGAGTTCTTCAAT
GGCAAGGAACCATCCCGTGGCATAAACCCAGATGAAGCTGTAGCGTATGGTGCTGCTGTC
CAGGCTGGTGTGCTCTCTGGTGATCAAGATACAGGTGACCTGGTACTGCTTGATGTATGT
CCCCTTACACTTGGTATTGAAACTGTGGGAGGTGTCATGACCAAACTGATTCCAAGGAAC
ACAGTGGTGCCTACCAAGAAGTCTCAGATCTTTTCTACAGCTTCTGATAATCAACCAACT
GTTACAATCAAGGTCTATGAAGGTGAAAGACCCCTGACAAAAGACAATCATCTTCTGGGT
ACATTTGATCTGACTGGAATTCCTCCTGCTCCTCGTGGGGTCCCACAGATTGAAGTCACC
TTTGAGATAGATGTGAATGGTATTCTTCGAGTGACAGCTGAAGACAAGGGTACAGGGAAC
AAAAATAAGATCACAATCACCAATGACCAGAATCGCCTGACACCTGAAGAAATCGAAAGG
ATGGTTAATGATGCTGAGAAGTTTGCTGAGGAAGACAAAAAGCTCAAGGAGCGCATTGAT
ACTAGAAATGAGTTGGAAAGCTATGCCTATTCTCTAAAGAATCAGATTGGAGATAAAGAA
AAGCTGGGAGGTAAACTTTCCTCTGAAGATAAGGAGACCATGGAAAAAGCTGTAGAAGAA
AAGATTGAATGGCTGGAAAGCCACCAAGATGCTGACATTGAAGACTTCAAAGCTAAGAAG
AAGGAACTGGAAGAAATTGTTCAACCAATTATCAGCAAACTCTATGGAAGTGCAGGCCCT
CCCCCAACTGGTGAAGAGGATACAGCAGAAAAAGATGAGTTGTAG

Clone variation with respect to NM_005347.4
Restriction Sites Please inquire |
ACCN NM_005347
Insert Size 2500 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_005347.2, NP_005338.1
RefSeq Size 3925 bp
RefSeq ORF 1965 bp
Locus ID 3309
UniProt ID P11021, V9HWB4
Cytogenetics 9q33.3
Domains HSP70
Protein Families Druggable Genome
Protein Pathways Antigen processing and presentation, Prion diseases
Summary The protein encoded by this gene is a member of the heat shock protein 70 (HSP70) family. This protein localizes to the lumen of the endoplasmic reticulum (ER) where it operates as a typical HSP70 chaperone involved in the folding and assembly of proteins in the ER and is a master regulator of ER homeostasis. During cellular stress, as during viral infection or tumorogenesis, this protein interacts with the transmembrane stress sensor proteins PERK (protein kinase R-like endoplasmic reticulum kinase), IRE1 (inositol-requiring kinase 1), and ATF6 (activating transcription factor 6) where it acts as a repressor of the unfolded protein response (UPR) and also plays a role in cellular apoptosis and senescence. Elevated expression and atypical translocation of this protein to the cell surface has been reported in viral infections and some types of cancer cells. At the cell surface this protein may facilitate viral attachment and entry to host cells. This gene is a therapeutic target for the treatment of coronavirus diseases and chemoresistant cancers. provided by RefSeq, Jul 2020
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_005347" in other vectors (6)
SKU Description Size Price
RC205859 HSPA5 (Myc-DDK-tagged)-Human heat shock 70kDa protein 5 (glucose-regulated protein, 78kDa) (HSPA5) 10 ug
$609.00
RC205859L1 Lenti ORF clone of Human heat shock 70kDa protein 5 (glucose-regulated protein, 78kDa) (HSPA5), Myc-DDK-tagged 10 ug
$909.00
RC205859L2 Lenti ORF clone of Human heat shock 70kDa protein 5 (glucose-regulated protein, 78kDa) (HSPA5), mGFP tagged 10 ug
$909.00
RC205859L3 Lenti ORF clone of Human heat shock 70kDa protein 5 (glucose-regulated protein, 78kDa) (HSPA5), Myc-DDK-tagged 10 ug
$909.00
RC205859L4 Lenti ORF clone of Human heat shock 70kDa protein 5 (glucose-regulated protein, 78kDa) (HSPA5), mGFP tagged 10 ug
$909.00
RG205859 HSPA5 (tGFP-tagged) - Human heat shock 70kDa protein 5 (glucose-regulated protein, 78kDa) (HSPA5) 10 ug
$489.00 $809.00

file-alt Citations

HHQ-4, a quinoline derivate, preferentially inhibits proliferation of glucose-deprived breast cancer cells as a GRP78 down-regulator
Xiao, Li, Zhang et al
Toxicol. Appl. Pharmacol. (2019) 373, 10-25 DOI: 10.1016/j.taap.2019.04.017
AI Summary: OriGene's human GRP78 cDNA clone (SC108086) in the pCMV6-XL5 vector was used to constitutively express GRP78 in breast cancer cells, enabling the study of its role in mediating resistance to HHQ-4-induced proliferation inhibition under glucose-deprived conditions.
Snippet: The human GRP78 cDNA was cloned into the pCMV6-XL5 vector at the EcoRI and SalI sites (SC108086, OriGene Technologies, Rockville, MD, USA);the human spliced XBP1 expression vector was a gift from Qingbo Xu & Lingfang Zeng (Addgene plasmid # 63680;
Glucose-regulated protein 78 demonstrates antiviral effects but is more suitable for hepatocellular carcinoma prevention in hepatitis B
Zheng, Zheng, Xu et al
Virol. J. (2017) 14 (1), 77 DOI: 10.1186/s12985-017-0747-z
AI Summary: OriGene products, specifically the GRP78-expressing recombinant plasmid (pGRP78) and its control plasmid (pCMV6-XL5, referred to as pVector), were used to modulate GRP78 expression and study its effects on HBV replication and hepatocellular carcinoma cell behavior in this research.
Snippet: Methods. Plasmid constructs and siRNA synthesis. GRP78-expressing recombinant plasmid, pGRP78, and its original plasmid pCMV6-XL5 (named as pVector in this study) were purchased from OriGene Technologies, Rockville, MD, USA. ... All 6 versions Cite SaveSaving
FigureFigureFigure
Discovery of a Novel Target for the Dysglycemic Chromogranin A Fragment Pancreastatin: Interaction with the Chaperone GRP78 to Influence Metabolism
Biswas, Friese, Gayen et al
PLoS ONE (2014) 9 (1), e84132 DOI: 10.1371/journal.pone.0084132
Cited by 24
AI Summary: In this study, the OriGene pCMV promoter-driven human GRP78 (HSPA5) expression plasmid was used to overexpress GRP78 in hepatocytes, enabling the researchers to investigate the effects of GRP78 modulation on glucose metabolism and its interaction with pancreastatin.
Snippet: The GRP78 (BIP) promoter-luciferase reporter was a gift from Bruce M. Spiegelman (Harvard Medical School). The pCMV promoter-driven human GRP78 (HSPA5) expression plasmid was from Origene <www.origene.com/>. ... Cite SaveSaving
FigureFigureFigure
Model-directed engineering of "difficult-to-express" monoclonal antibody production by Chinese hamster ovary cells
Pybus, Dean, West et al
Biotechnol. Bioeng. (2013)
Cited by 105
AI Summary: OriGene products contributed to this study by providing plasmids encoding human BiP (HSPA5), Cyclophilin B (PPIB), and PDI (P4HB), which were used to co-express molecular chaperones and foldases in CHO cells to improve the production of difficult-to-express monoclonal antibodies.
Snippet: efficiency. Molecular chaperone and foldase genes driven by CMV promoters were encoded on plasmids from OriGene (Rockville, MD, USA), specifically human BiP (HSPA5), human Cyclophilin B (PPIB), and human PDI (P4HB).
Androgen receptor inclusions acquire GRP78/BiP to ameliorate androgen-induced protein misfolding stress in embryonic stem cells
Yang, Fu, Hsiao et al
Cell Death Dis (2013) 4, e607 DOI: 10.1038/cddis.2013.122
Cited by 21
AI Summary: OriGene’s pCMV6-XL5-GRP78/BiP plasmid was used in this study to overexpress GRP78/BiP in embryonic stem cells, enabling the authors to investigate its role in modulating androgen receptor aggregation and cellular stress responses.
Snippet: 2 pCMV-3xFLAG-ATF6 was obtained from Dr. Ron Prywes and pCMV6-XL5-GRP78/BiP was purchased from Origene (Rockville, MD ... 1-vector with packing plasmids (pCMV-ΔR8.91) and envelope plasmid (VSV-G), using Lipofectamine 2000 reagent (Life Technologies, Carlsbad
FigureFigureFigure
GRP78 regulates clusterin stability, retrotranslocation and mitochondrial localization under ER stress in prostate cancer
Li, Zoubeidi, Beraldi et al
Oncogene (2013) 32 (15), 1933-42 DOI: 10.1038/onc.2012.212
Cited by 118
AI Summary: OriGene’s Human GRP78 (HSPA5; NM_005347.2) cDNA was used in this study to investigate the role of GRP78 in regulating clusterin stability, retrotranslocation, and mitochondrial localization under ER stress in prostate cancer cells.
Snippet: Human GRP78 (HSPA5;NM_005347.2) cDNA (Origene, Rockville, MD, USA) was used for further subcloning into pHR–CMV lenti-viral vector;5′- or 3′-flanking BamHI or XhoI ... | Article | PubMed | CAS |;Meusser B, Hirsch C, Jarosch E, Sommer T. ERAD: the long road to
Showing 1-6 of 8 papers.
Powered by BizGenius
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products