OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

PCBD2 (NM_032151) Human Untagged Clone

Be the first to review this product
SKU
SC106047
PCBD2 (untagged)-Human pterin-4 alpha-carbinolamine dehydratase/dimerization cofactor of hepatocyte nuclear factor 1 alpha (TCF1) 2 (PCBD2)
  $150.00
In Stock*
Bulk Requests & Clone Modifications

Frequently Bought Together (4)

TA342966 Rabbit Polyclonal Anti-PCBD2 Antibody
100 ul
$585.00
CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "PCBD2 or NM_032151"

Specifications
Specifications
Product Data
Type Human Untagged Clone
Target Symbol PCBD2
Synonyms DCOH2; DCOHM; PHS2
Vector pCMV6-XL4
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
Fully Sequenced ORF
>NCBI ORF sequence for NM_032151, the custom clone sequence may differ by one or more nucleotides


ATGGCGGCGGTGCTCGGGGCGCTCGGGGCGACGCGGCGCTTGTTGGCGGCGCTGCGAGGCCAGAGCCTAG
GGCTAGCGGCCATGTCATCAGGTACTCACAGGTTGACTGCAGAGGAGAGGAACCAAGCTATACTTGACCT
TAAAGCAGCAGGATGGTCGGAATTAAGTGAGAGAGATGCCATCTACAAAGAATTCTCCTTCCACAATTTT
AATCAGGCATTTGGCTTTATGTCCCGAGTTGCCCTACAAGCAGAGAAGATGAATCATCACCCAGAATGGT
TCAATGTATACAACAAGGTCCAGATAACTCTCACCTCACATGACTGTGGTGAACTGACCAAAAAAGATGT
GAAGCTGGCCAAGTTTATTGAAAAAGCAGCTGCTTCTGTGTGA

5' Read Nucleotide Sequence
>OriGene 5' read for NM_032151 unedited
NGGTTAGGATTTGTATCCGACTTCTATAGGCGGCCGCGCATTCGGCACCAGGTTTTGCGC
TTATCTAGCCTTGCTTTGGTCTCTTTAAGAGAACAAAGGAATGAAAGATGGTTAGAATTT
GTTGCCTTTCAGACTTTTCTACATCTCTGCTTAAGGTAAGGAGCCATAAGTTTGAGTTTG
AGTAAACTTGTACATTTTCAGATATGAAATGTGTTCTCTTCATAGTCATCAGGTACTCAC
AGGTTGACTGCAGAGGAGAGGAACCAAGCTATACTTGACCTTAAAGCAGCAGGATGGTCG
GAATTAAGTGAGAGAGATGCCATCTACAAAGAATTCTCCTTCCACAATTTTAATCAGGTA
ATTGTTATAAATTCTTGCTAGGGCTGTGGTCTATTTTAGTCACCTTAGGCCATAACACTT
TCTGATTCTGCCAGTTGTCTGGTCCCATGTAGATCTAGGATTCAACTCTTCCCTTCTTTA
AGAATTCAGTGATAGAGTGACATCCTTGTTGACAGTTGCTACCACCCACCTGGGTGGTGT
TTAGCTCTGGGGGAAGAGGGTGGTTTGTGTTACTTGGAAAACAAATTCTGAAACCACTAT
TGCTTTGGTATGGTGTTGGTTAGGATATGTAGTTTCTTTTGAAATTTCAAATAACATTAA
AAGAGAGTGTAAGCCTTTTATTATTGATTATTATTTTTTGAGACAGGGTCTTGCTCTGTT
GCCCAGGCTGGAGTACAGTGGTATGATTGTGGCTTACTGCTGCCTCGACCTCCTGGGCTC
ANGTGATCCTCCCACCTTAGCCTNCTGAGTAGCTGGGACTACAGGCATGTGCCATGCCCC
AGCTATTTTGCATTGNTNNGAGAGCANGGTCTGGCTATGNTGCCCAGACTGGTCTCAAAT
TCTGGNCTCAGCGATCT
Restriction Sites NotI-NotI |
ACCN NM_032151
Insert Size 2900 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_032151.3, NP_115527.2
RefSeq Size 2395 bp
RefSeq ORF 390 bp
Locus ID 84105
UniProt ID Q9H0N5
Cytogenetics 5q31.1
Domains Pterin_4a
Protein Families Druggable Genome, Transcription Factors
Summary Involved in tetrahydrobiopterin biosynthesis. Seems to both prevent the formation of 7-pterins and accelerate the formation of quinonoid-BH2 (By similarity).UniProtKB/Swiss-Prot Function
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_032151" in other vectors (5)
SKU Description Size Price
RC208859 PCBD2 (Myc-DDK-tagged)-Human pterin-4 alpha-carbinolamine dehydratase/dimerization cofactor of hepatocyte nuclear factor 1 alpha (TCF1) 2 (PCBD2) 10 ug
$150.00
RC208859L3 Lenti ORF clone of Human pterin-4 alpha-carbinolamine dehydratase/dimerization cofactor of hepatocyte nuclear factor 1 alpha (TCF1) 2 (PCBD2), Myc-DDK-tagged 10 ug
$450.00
RC208859L4 Lenti ORF clone of Human pterin-4 alpha-carbinolamine dehydratase/dimerization cofactor of hepatocyte nuclear factor 1 alpha (TCF1) 2 (PCBD2), mGFP tagged 10 ug
$450.00
RG208859 PCBD2 (tGFP-tagged) - Human pterin-4 alpha-carbinolamine dehydratase/dimerization cofactor of hepatocyte nuclear factor 1 alpha (TCF1) 2 (PCBD2) 10 ug
$489.00
SC317230 PCBD2 (untagged)-Human pterin-4 alpha-carbinolamine dehydratase/dimerization cofactor of hepatocyte nuclear factor 1 alpha (TCF1) 2 (PCBD2) 10 ug
$165.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products