OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

DIRAS1 (NM_145173) Human Untagged Clone

Be the first to review this product
SKU
SC100097
DIRAS1 (untagged)-Human DIRAS family, GTP-binding RAS-like 1 (DIRAS1)
  $300.00
In Stock*
Bulk Requests & Clone Modifications

Frequently Bought Together (4)

TA351142 Rabbit Polyclonal Anti-DIRAS1 Antibody
100 ul
$205.00
CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "DIRAS1 or NM_145173"

Specifications
Specifications
Product Data
Type Human Untagged Clone
Target Symbol DIRAS1
Synonyms Di-Ras1; GBTS1; RIG
Vector pCMV6-XL4
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
Fully Sequenced ORF
>OriGene ORF within SC100097 sequence for NM_145173 edited (data generated by NextGen Sequencing)
ATGCCGGAACAGAGTAACGATTACCGCGTGGTGGTGTTCGGGGCGGGCGGCGTGGGCAAG
AGCTCGCTGGTGCTGCGCTTCGTGAAGGGCACGTTCCGCGACACCTACATCCCCACCATC
GAGGACACCTACCGGCAGGTGATCAGCTGCGACAAGAGCGTGTGCACGCTGCAGATCACA
GACACCACCGGCAGCCACCAGTTCCCGGCCATGCAGCGCCTGTCCATCTCCAAGGGCCAC
GCCTTCATCCTGGTGTTCTCCGTCACCAGCAAGCAGTCGCTGGAGGAGCTGGGGCCCATC
TACAAGCTCATCGTGCAGATCAAGGGCAGCGTGGAGGACATCCCCGTGATGCTCGTGGGC
AACAAGTGCGATGAGACGCAGCGGGAGGTGGACACGCGCGAGGCGCAGGCGGTGGCCCAG
GAGTGGAAGTGCGCTTTCATGGAGACCTCGGCCAAGATGAACTACAACGTCAAGGAGCTC
TTCCAGGAGCTGCTGACGCTGGAGACGCGCCGGAACATGAGCCTCAACATCGACGGCAAG
CGCTCCGGCAAGCAGAAGAGGACAGACCGCGTCAAGGGCAAATGCACCCTCATGTGA

Clone variation with respect to NM_145173.3
549 g=>c
5' Read Nucleotide Sequence
>OriGene 5' read for NM_145173 unedited
CGACTCACTATAGGCGGCCGCGAATTCGCACGAGGGGGGACGGCGCGGGCGCGACTGCGG
CGGCTCGGGCGGGCGGGGGGCGGCGGCGCCAGCGGACACCGGAGCGGGCAGGAGCAGCGG
CCGCGGCGCCGCAGGGACCAGCGGGCCCAGGCTCGGTCTGGGGTTCTTGCAGCTGGCACC
AGCCCTCCCGGCCCCGGCCGCCCACCCGCCGCGGGGAAACATGCCGGAACAGAGTAACGA
TTACCGCGTGGTGGTGTTCGGGGCGGGCGGCGTGGGCAAGAGCTCGCTGGTGCTGCGCTT
CGTGAAGGGCACGTTCCGCGACACCTACATCCCCACCATCGAGGACACCTACCGGCAGGT
GATCAGCTGCGACAAGAGCGTGTGCACGCTGCAGATCACAGACACCACCGGCAGCCACCA
GTTCCCGGCCATGCAGCGCCTGTCCATCTCCAAGGGCCACGCCTTCATCCTGGTGTTCTC
CGTCACCAGCAAGCAGTCGCTGGAGGAGCTGGGGCCCATCTACAAGCTCATCGTGCAGAT
CAAGGGCAGCGTGGAGGACATCCCCGTGATGCTCGTGGGCAACAAGTGCGATGAGACGCA
GCGGGAGGTGGACACGCGCGAGGCGCACGCGGTGGCCCAGGAGTGGAAGTGCGCTTTCAT
GGAGACCTCGGCCAAGATGAACTACAACGTCAAGGAGCTCTTCCAGNAGCTGCTGACGCT
GGAGACGCGCCGGAACATGAGCCTCACATTGACGGCAAGCGCTNCGGCAAGCAGAAGAGA
CAGACCGCGTCAGGGGCAAATGCACCCTCATGTGAGCCCGGACGCCCGGCTGGGCCGGTG
GCACACCCAACTGACCCCGGTGGTTCCCCGAAACGACACACTTGCTGGACCCTCTGTTTT
TTTATCCCCCTGGCCACCTTGGCGGTGAAACCGGGCCACA
Restriction Sites NotI-NotI |
ACCN NM_145173
Insert Size 3500 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_145173.1, NP_660156.1
RefSeq Size 3391 bp
RefSeq ORF 597 bp
Locus ID 148252
UniProt ID O95057
Cytogenetics 19p13.3
Domains RAB, ras, RAS, RHO
Summary DIRAS1 belongs to a distinct branch of the functionally diverse Ras (see HRAS; MIM 190020) superfamily of monomeric GTPases.supplied by OMIM, Apr 2004
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_145173" in other vectors (4)
SKU Description Size Price
RC206160 DIRAS1 (Myc-DDK-tagged)-Human DIRAS family, GTP-binding RAS-like 1 (DIRAS1) 10 ug
$300.00
RC206160L3 Lenti ORF clone of Human DIRAS family, GTP-binding RAS-like 1 (DIRAS1), Myc-DDK-tagged 10 ug
$600.00
RC206160L4 Lenti ORF clone of Human DIRAS family, GTP-binding RAS-like 1 (DIRAS1), mGFP tagged 10 ug
$600.00
RG206160 DIRAS1 (tGFP-tagged) - Human DIRAS family, GTP-binding RAS-like 1 (DIRAS1) 10 ug
$489.00 $500.00

file-alt Citations

RAS-related GTPases DIRAS1 and DIRAS2 induce autophagic cancer cell death and are required for autophagy in murine ovarian cancer cells
Sutton, Yang, Huang et al
Autophagy (2018)
AI Summary: In this study, OriGene products—including the anti-DIRAS2 antibody (TA809398) and pCMV-DIRAS1 and pCMV-DIRAS2 mouse and human plasmids (SC100097)—were used to detect DIRAS2 protein expression and to re-express DIRAS1 and DIRAS2 in cancer cells, enabling the investigation of their roles in autophagy and cancer cell death.
Snippet: other members of the DIRAS family. Antibody against DIRAS2 (TA 809398) was purchased from Origene. AKT (sc-514302) and MAPK/ERK (sc-514302) antibodies pCMV-DIRAS1 and pCMV- DIRAS2 mouse and human plasmids were purchased from Origene (SC100097
Showing 1-1 of 1 papers.
Powered by BizGenius
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products