Qser1 (NM_001123327) Mouse Untagged Clone

CAT#: MC224838

Qser1 (untagged) - Mouse glutamine and serine rich 1 (Qser1), (10ug)

  View "NM_001123327" in other vectors (2)

USD 2,790.00


Availability*
8 Weeks

Size
    • 10 ug


Product images

Specifications

Product Data
Product Name Qser1 (NM_001123327) Mouse Untagged Clone
Symbol Qser1
Synonyms 4732486I23Rik; AI502974
Vector pCMV6-Entry
Sequence Data
>MC224838 representing NM_001123327
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGCATTCCTCAGCAGCAACTGAGCTGTTTGTTGCAGGACCCTTGCCAACCACTGGGACACTTCCACCAC
CAACTTTGTCTGCCTATCAGCATTCATCTACCTTTAGCAATAGAAACTTTGCGACCACCTCACCTTTGGT
GCTTCAAGATTCATCTTTTAACACTACATCCAATGGAATTTTAAGCCCTCATGACCCTTTGCTACAAATT
AAGACTTCCCAGGGAACTGTTCCGACTGCTTTGGCATTTGAGCGCCTGGGCAGTTCTGCATTAAGTAACA
GCGTACCACCTCAGTCTTCAACATATCGCTCAGCTCAAGAGTCAGCACCCCATCTTTTACAACCTCAATT
TAGTTTGTTGCCTTCAACACTTGGGGGAGCCCAGCAAACCCCTCAAGCCTATAATTCAGCTCTTTTTCCT
AGTTCTGCTGCTTCCATTGAAAGAGCCCTTCTTCGAGAATGTAGCGTTATTAAACACCACCAGCGGCCTT
CAGTTACCCAGTCTATTCAGGCACAACTGACTGGTTCACAGCATCCCTTACATAGCTACCTATCAAGTGC
AAGTATTGGTAATTTTCAGGAACCATCCAGGCAGTCGTCTTTATCCTGTAGTTCAGTTCGAGATTCTACT
CAGGTGAGCAATGGAGTATTGCCGCAGAAGACCCCTCAGGTCTCAGCAGAACTTGCTCAGTCTTACTCAT
CTGTAATTCCATCATCAGGGTATCTTCCTTCTGCTACAAAAGTAGACAGCTGTTCTACAAAACAACCACT
AACATCAACTACAATTCCGAAGCCTCAAAGTGTAATTCCTCCTGTGCAAACACTAAACTATTCTAAACCT
TTACATAACCAGAGTTCTGTAATATCAGGTCAAGCACAAATTTATTCTACAGCACAGCTACCAAGCCTTT
TATCAGTCAGTCAGTCCCAAAATTATGGTTTAGTACAGCCACATAATGTGCCATCTATTGTTCATTCACA
GGTTTATAGGTCCAGCAGGGTTGAGAAATTGCCATCCTTATATAAAACATTGACTTTTTCTGGGTCATCT
CAGCCTGTAACCTCTGAAAACCAGACACTTAGTTATTCATCCAATCAGCAAGAAGTATTATCCTTAGTTA
CAAATGAGAATTATCCTGCTCAAACAAGAGACCTGCCATCAGTCAGTGAGTCTCAAAATTATTCTTCTGG
TCAGTCTCAGGGTTTATCACCAGTTAGCCAAACACAGGTCAGTTATTCATCTCAGTCTCAAGTTTTATCA
GTTGTTAGTCCTTCAGAAAGCTATGCATCAGGACAGTCTCTGACATTAACAGCCCCTTCTCTTTCTTATT
CTTCTGCCTCTCGGGGTCAGAGCTTGCCAGTTTCTACCCCAACACCAAGTTATACTTCTATGCATCCATC
CCCAAATGCTCAGACCCAAGGATCTTCTGCTCAGCCCCAAGAGTTTCTGCCTGCTGTGCAGTCCTCTTTT
GCATCCTCTACTCGTGGTCAGACATTACAAAGTAGCATACCTTCTCCTGATCCAAAGTCTTATGCTGAAA
GGAAGCTTGACTCAAGTGTGTATACATCGTCAAAGCAAGATGAGTTTCCAGTGCAAAAATTACAGGCATT
GCAGTCACAAGCATCTCTTGAATCATCAAGCCAAAGGCTACCCGATGGGGAAGTGAATGCTCAAGAGTCA
GTTTATAAGACATCAAAGGCAGATGATAGGTATTCTCAGAGTGTAACCAGAAATAACTCTCACCTTGAAG
ATCAAGTTGTTGGAGTTGCTCTCCAGGGTTCAGAACAGGAAGAAAACATGGTCGGTTCAATGACACAACT
TAACCAGCAAAGTGGCCAGTCCAATAATGCAGTAGCCACTGATCTTAAGAAGGCAACTAATTTAATGCAA
ACTCCACAGGTAAGGTTGAATACTAAAGACCTCAACCAGCAGCATTCTCTCATGCACAAGATGCATGAAG
CGAAGGTTCAGCAACAGCATGATCAAATAATGAGTGCCTCATCTCAGATACAGATTCCAAATCCTGCTTT
AGGGCAGAGTCATCAGGCTCTTCCTCATACATCAGTCCTTTTAGACTCTGCCTGTGACTTACAGATTCTT
CAACAGGCTGGAATTCTCCAGGCTAGCCTGGGACAAGCAAAGGCATCCTTGCAAGTACAGCGTGTTCAGA
GTCCGCAACAGATAGTCCATCCTTTCCTACAGATGGATGGTCATATCATCCAGAGCAACGGTGAACATCC
TCAACAGCAGCTCCATCCTCACAATTCTGATATTATGAAACTAGACCTCCCTGAACCTTCAAAACCATTG
CAACAGCTAACAACAAAGGGCCCCTTCAGTGAAGCCAATCCACATGACTCAAAGAATCAGTTTGTTTCTC
TTGGATCAATATGCTTCTCAGAGGCAATGCTTCTCAGTGATGAAAGAAATATTTTATCAAATGTAGATGA
CATCTTAGCAGCTACAGCAGCAGCTTGTGGGGTTACACCTTCTGACTTTTCCAAGTCAGCTGCAAATGAA
ACCATGCAAGATATTGAAAGTAGTGATTCTAAGTCTCATTATCAGCAGTCATTAAATGTCAGGCATGTGA
ATTCAGATTTTAACTCCATAGCAGCTTCAGTAGGAAAGCCACAGAGTATTAATGATATTTCCTTAAATGG
AAATCAGGTTAGTGTGAGTCTTTCATCAGTGCCCACCCTTCAGTCAGAAACAGTTCTTGATCAACCGCAT
ATGGAAACACCTAGTCAAACTATACCAACTAAAGTACCTTCTGCCATGGTTGGACTGGGTCAGGAAATCC
AGGAACAAAGTTCTGACCCATTCAAGAAACAGTTGACTATAAACCATGAGTCTAAAGAAGACAGGGAAAT
TGCTGTTGACAGTGCACTGAGTAATAACAGAAATCAAGAGTTTGTCTCTAATAGTCGGAGCATAAGTGGA
GACAGTGTAGTATCAGAGCGTGACTTTACCCTAGTAGGTGATGACACTGGTGTGTTGGTGAACCCTAGAA
GGAGTACACTTGCACTGCTGGCCATGCCCCAGCCAGGGGATGCAGCCAGTGGCAAGACTGAAGATGAAAA
ACAAGATGTAACATATTTTAACCTTCCAAAGGAAAAAGCTAAAGGAAAAGAACAAGGTAAAGAGGAAGAA
GATAATCAAAAACAGCTGAAAAGGTCTGCTCAATGCAAGCGACAGAACCCCAGAGGGACAGATGTGTATG
TACCATACACTTCCCCTTCCTTGGAAAGCTGCGATGAAGGTTTTCAGCATCAAGAAAAGATGAGGCAGAA
AATCAAGGAAGTGGAGGAAAAGCAGCCAGAGGTCAAAACAGGATTTATTGCTTCTTTTTTAGACTTCCTG
AAGTGTGGGCCCAAGCAGCAGTTCTCCACTCTTGCTGTTCGAGTACCTAACAGAACCAGACGATCAGGAA
TCCAAACCACCCGTACGTTCTGTCCCCCACCTTTTGCAAAGACATCACCTGCAGCACAAGCACCATCTGA
AACAGGAGGGGTCAGTCTGTCAGAAAAAGTTGACAGTGAACTTAAAACTTTAGAACAATTATCTTCATTT
TCTTCTGATGAGGAAGATCCTGGCTCGTGTGGCCATGATATCTATAAGAACACCTCTGCTCCTTTAACTG
TGTTGGATGCTACTTCCGATAAAACAAAGAAAACAGTTTTAGAAGCTCTGCCTGTGGCAACTCCTGGTGC
ATCTGCTGAGACTGCTGGTGTTGCTCCCACTGCCTCCACTGCTGTTGCAACAATTAAACAAGACCTTCAT
CTGACTTCATTAACTGTCAACACCATGGAAAATGCCAACTCCACAGAATCCCCCACAGCCATCGAACTTG
ATAGTCTTCCTTCAGACCAGTTGGCAAAAGGACAGGACACAGTTGCAATAGAAGGTTTTACAGATGAGGA
AAATATTGAAAGTGGAGGTGAAGGTCAATACAGGGAACGTGATGAATTTGTGGTAAAGATAGAAGACATA
GAGACCTTTAAGGAGGCTTTAAATACGGGAAAAGAGCCCCCAGCTATTTGGAAAGTACAGAAAGCTTTGT
TACAGAAATTTGTTCCTGAAATTCGAGATGGGCAAAGAGAATTTGCAGCTACAAATAGTTACCTTGGGTA
TTTTGGAGATGCAAAAACTAAATACAAAAGGATATATGTGAAGTTCATTGAAAATGCAAACAAAAAGGAA
TATGTCAGAGTGTGTTCCAAAAAGCCAAGAAATAAGCCTTCACAAACTATCAGAAATATTCCATCTAAGC
CAAGTAGTATCAGTAAAACTTCTGACCCACCAGTATCAAAAACTACAACTACAAAAACCCCGTCTACAAA
ACCCAAAGCTAAACAGCTCAAAATAAAGGCTGAGCCACCACCAAAGAAAAGGAAGAAATGGAAGGAAGAA
TTTTCATCATCACAATCTGAATCATCTCCTGAGGTCCGTTCTAGCAGTAGTGAGGATGAGGGCTTTGAGC
CTCCAGCCCCCTCTGTCACTCGTTTTCTGAACACAAGAGCAATGAAGGAAACTTTCAAGAGTTACATGGA
ATTGCTTGTTAGCATTGCTCTGGATCCTGACACCATGCAAGCCCTAGAAAAGAGCAACGATGAGCTACTT
TTACCACATATGAAAAAAATAGATGGAATGCTGAATGATAACCGGAAAAGACTTCTTGTGAATCTTCATT
TGGACCAGCCATTCAAGAATGCTTTGGAAAGTTTTCCTGAACTGACAGTTATTACTCGAGACTCTAAAGC
AAAGAGTGGAGGATCTGCTATTTCTAAGATCAAAATGAATGGCAAAGCTTATAATAAGAAAACTCTAAGG
ACTTCTAAAACAACCACTAAGTCTGCACAGGAGTTTGCTGTTGATCCAGAGAAAATACAGTTATATTCCT
TATATCATTCACTCCATCATTATAAATACCATGTTTATCTCATATGTAAGAATGAGATATCATCTGTGCA
GAAAAAAAATGAAGATTTAGGACAGGAAGAAATTGTTCAACTTTGTATGAAAAATGTAAAGTGGGTGGAG
GACCTATTTGAAAAATTTGGAGAACTTCTAAATCATGTACAACAGAAATGTTCCTAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
Tag Tag Free
ACCN NM_001123327
ORF Size 5097 bp
Insert Size 5097
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_001123327.2, NP_001116799
RefSeq Size 8975
RefSeq ORF 5097
Locus ID 99003
Cytogenetics 2|2 E2

Other Versions

Other products for "Qser1"
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.
10 percent off protein banner ad
68 Mouse Clones
20%off selected tag antibodies