OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

Snrpa (NM_001046637) Mouse Untagged Clone

Be the first to review this product
SKU
MC218760
Snrpa (untagged) - Mouse small nuclear ribonucleoprotein polypeptide A (Snrpa), transcript variant 2, (10ug)
Interest in protein/lysate? Submit request here!
ORF Plasmid:
Tag Free tGFP DDK
AAV Particle:
DDK
  $330.00
4 Weeks*
Bulk Requests & Clone Modifications

Frequently Bought Together (3)

CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "Snrpa or NM_001046637"

Specifications
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Snrpa
Synonyms C430021M15Rik; Rnu1a-1; Rnu1a1; U1-A; U1A
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>MC218760 representing NM_001046637
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCCACCATAGCCACCATGCCAGTTCCCGAGACCCGTGCCAACCACACTATTTATATCAACAATCTCA
ATGAGAAGATCAAGAAGGATGAGCTCAAGAAGTCCCTGTATGCCATCTTCTCCCAGTTTGGCCAGATCCT
GGATATCCTGGTGTCTCGGATCATGAAGATGAGGGGCCAGGCCTTCGTCATCTTCAAGGAGGTCACCAGC
GCCACCAATGCCCTGCGCTCCATGCAGGGCTTCCCTTTCTACGACAAGCCCATGCGCATCCAGTACGCAA
AGACTGACTCGGACATCATTGCCAAGATGAAGGGCACCTATGTGGAGAGAGATCGCAAACGAGAGAAGAG
GAAGCCCAAGAGTCAGGAGACACCTGCTGCCAAAAAGGCTGTTCAGGGTGGGGCAGCTGCGCCCGTGGTG
GGGGCTGTCCAGCCCGTACCGGGCATGCCACCGATGCCTCAGGCACCCCGCATCATGCACCATATGCCAG
GACAGCCTCCCTACATGCCGCCACCTGGCATGATCCCGCCACCAGGCCTCGCTCCTGGCCAGATCCCCCC
TGGGGCCATGCCCCCACAGCAGCTCATGCCTGGGCAGATGCCGCCTGCCCAGCCTCTCTCCGAGAACCCA
CCCAATCACATCCTGTTCCTCACCAACCTGCCTGAGGAGACCAACGAGCTCATGCTCTCCATGCTCTTCA
ACCAGTTCCCTGGCTTCAAGGAGGTGCGTCTGGTCCCTGGGCGCCATGACATCGCCTTCGTGGAGTTTGA
CAATGAAGTGCAGGCTGGGGCAGCACGAGATGCCCTGCAAGGCTTTAAGATCACACAAAACAATGCTATG
AAGATCTCTTTTGCCAAGAAGTAG

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI |
ACCN NM_001046637
Insert Size 864 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001046637.1, NP_001040102.1
RefSeq Size 1305 bp
RefSeq ORF 864 bp
Locus ID 53607
UniProt ID Q62189
Cytogenetics 7 A3
Summary Component of the spliceosomal U1 snRNP, which is essential for recognition of the pre-mRNA 5' splice-site and the subsequent assembly of the spliceosome. U1 snRNP is the first snRNP to interact with pre-mRNA. This interaction is required for the subsequent binding of U2 snRNP and the U4/U6/U5 tri-snRNP. SNRPA binds stem loop II of U1 snRNA. In a snRNP-free form (SF-A) may be involved in coupled pre-mRNA splicing and polyadenylation process. May bind preferentially to the 5'-UGCAC-3' motif on RNAs (By similarity).UniProtKB/Swiss-Prot Function
Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. Variants 1, 2 and 3 encode the same protein.
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_001046637" in other vectors (5)
SKU Description Size Price
MC200003 Snrpa (untagged) - Mouse small nuclear ribonucleoprotein polypeptide A (Snrpa), transcript variant 2, (10ug) 10 ug
$300.00
MG203911 Snrpa (tGFP-tagged) - Mouse small nuclear ribonucleoprotein polypeptide A (Snrpa), transcript variant 2 10 ug
$500.00
MR203914 Snrpa (Myc-DDK-tagged) - Mouse small nuclear ribonucleoprotein polypeptide A (Snrpa), transcript variant 2 10 ug
$289.00 $300.00
MR203914L3 Lenti ORF clone of Snrpa (Myc-DDK-tagged) - Mouse small nuclear ribonucleoprotein polypeptide A (Snrpa), transcript variant 2 10 ug
$600.00
MR203914L4 Lenti ORF clone of Snrpa (mGFP-tagged) - Mouse small nuclear ribonucleoprotein polypeptide A (Snrpa), transcript variant 2 10 ug
$600.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products