OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

Trim11 (BC020102) Mouse Untagged Clone

Be the first to review this product
SKU
MC218513
Trim11 (untagged) - Mouse tripartite motif protein 11 (cDNA clone MGC:28318 IMAGE:4014766), (10ug)
Interest in protein/lysate? Submit request here!
ORF Plasmid:
Tag Free tGFP DDK
AAV Particle:
DDK
  $503.00
3 Weeks*
Bulk Requests & Clone Modifications

Frequently Bought Together (4)

TA330505 Rabbit Polyclonal Anti-TRIM11 Antibody
100 ul
$585.00
CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "Trim11 or BC020102"

Specifications
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Trim11
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>BC020102
Red=Cloning site Blue=ORF Green=Tags(s)

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCTGCCCCAGACTTGTCCACCAACCTCCAGGAGGAGGCCACCTGCGCCATCTGCCTGGATTACTTCA
CCGACCCGGTGATGACCGACTGCGGCCACAACTTCTGCCGCGAGTGCATCCGACGTTGCTGGGGCCAGCC
CGAGGGCCCATACGCGTGCCCCGAGTGTCGCGAGCTGTCGGCGCAGAGGAACCTACGGCCCAACCGCCCG
CTCGCCAAAATGGCAGAAATGGCACGACGCCTGCACCCGCCTTCTCCGGTCCCGCAGGGCGTCTGTGCGG
CGCACCGCGAGCCGCTGACCACCTTCTGCGGCGACGACCTCAGCCTGCTGTGCCCCATCTGCGAGCGTTC
GGAGCACTGGACTCACCGGGTGAGACCGCTGCAGGAGGCGGCGGACGACCTCAAGGGGAGGCTGGAGAAG
TCACTGGAGCACCTACGGAAACAAATGGAGGACGCAATGCTGTTCCAAGCCCAGGCTGAGGAAACCTGTG
CCTTGTGGCAGAAGATGGTGGAGAGCCAGCGGCAGAATGTGCTGGGCGAGTTTGAGAGGCTGCGCCGCCT
GTTGGCAGAGGAGGAGCAACAGCTGCTGCAGAAGCTGGAGGAGGAAGAGCTGGAGGTTCTGCCGCGCCTG
CGTGAAGGCGCTGCGAGGCTTGGCCAGCAAAGCACGCAGCTGGCAGCCCTCATCTCCGAGCTTGAGAGCC
GCTGCCAGCTGCCAGCCCTGGGTTTACTGCAGCTCTGCATTGAGTGCTGCGCCCTGGAGAGAGAAGCGTC
TATAGCCAAGGACATTAAGGACGCCCTGTGCAGGGTGCAGGATGTGAAGCTGCAGCCTCCAGCAGTGGTG
CCCATGGAGCTGAGGACCGTGTGCCGGGTCCCAGGGCTGGTGGAGACCCTGCGGAGGTTCCGAGGGGACA
TAACCCTGGACCCAGACACCGCCAACCCTGAGCTGGTCTTATCTGAGGACCGGAGGAGTGTGCAGCGTGG
TGAACAGCGGCAGGCCCTGCCTGACAACCCAGAGCGGTTCGACCCTGGCCCTTGTGTGCTGGGCCAGGAG
CGCATTACCTCTGGCCGCCACTACTGGGAGGTGGAAGTCGGGGACCAGACCAGCTGGGCACTCGGCGTGT
GTAAAGAAACTGCCAACAGGAAGGAGAAGGGGGAGCTGTCGGCTGGCAATGGGTTCTGGATCCTGGTGTT
CCTGGGGAGTTTCTATAATTCCAATGAGCCGGCCTTCTCCCCACTGCGGGACCCTCCCAAGCGTGTGGGG
ATTTTTCTGGACTATGAAGCTGGCCATCTCTCATTCTACAGTGCCACGGATGGGTCGCTGCTGTTTATCT
TCCCCGAGACCCTGTTCTCAGGGACACTCCGGCCCCTCTTCTCACCTCTGTCAAGCAGCCCAACCCCTAT
GACTATCTGCAGGCTGATAGGTGTATCTGGGGACACCCTTGGTCCGCAGTGA

AGCGGACCGACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCTGAAGAGGATCTGGCAGCAAATGATA
TCCTGGATTACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-RsrII |
ACCN BC020102
Insert Size 1452 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq BC020102, AAH20102
RefSeq Size 2322 bp
RefSeq ORF 1451 bp
Locus ID 94091
Cytogenetics 11 B1.3
Summary E3 ubiquitin-protein ligase that promotes the degradation of insoluble ubiquitinated proteins, including insoluble PAX6, poly-Gln repeat expanded HTT and poly-Ala repeat expanded ARX. Mediates PAX6 ubiquitination leading to proteasomal degradation, thereby modulating cortical neurogenesis. May also inhibit PAX6 transcriptional activity, possibly in part by preventing the binding of PAX6 to its consensus sequences. May contribute to the regulation of the intracellular level of HN (humanin) or HN-containing proteins through the proteasomal degradation pathway. Mediates MED15 ubiquitination leading to proteasomal degradation. May contribute to the innate restriction of retroviruses. Upon overexpression, reduces HIV-1 and murine leukemia virus infectivity, by suppressing viral gene expression. Antiviral activity depends on a functional E3 ubiquitin-protein ligase domain. May regulate TRIM5 turnover via the proteasome pathway, thus counteracting the TRIM5-mediated cross-species restriction of retroviral infection at early stages of the retroviral life cycle.UniProtKB/Swiss-Prot Function
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"BC020102" in other vectors (4)
SKU Description Size Price
MG207741 Trim11 (tGFP-tagged) - Mouse tripartite motif protein 11 (cDNA clone MGC:28318 IMAGE:4014766) 10 ug
$657.00
MR207741 Trim11 (Myc-DDK-tagged) - Mouse tripartite motif protein 11 (cDNA clone MGC:28318 IMAGE:4014766) 10 ug
$289.00 $457.00
MR207741L3 Lenti ORF clone of Trim11 (Myc-DDK-tagged) - Mouse tripartite motif protein 11 (cDNA clone MGC:28318 IMAGE:4014766) 10 ug
$757.00
MR207741L4 Lenti ORF clone of Trim11 (mGFP-tagged) - Mouse tripartite motif protein 11 (cDNA clone MGC:28318 IMAGE:4014766) 10 ug
$757.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products