OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

Psmd8 (BC004075) Mouse Untagged Clone

Be the first to review this product
SKU
MC218339
Psmd8 (untagged) - Mouse proteasome (prosome, macropain) 26S subunit, non-ATPase, 8 (cDNA clone MGC:8242 IMAGE:3591796), complete, (10ug)
Interest in protein/lysate? Submit request here!
ORF Plasmid:
Tag Free tGFP DDK
AAV Particle:
DDK
  $330.00
3 Weeks*
Bulk Requests & Clone Modifications

Frequently Bought Together (3)

CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "Psmd8 or BC004075"

Specifications
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Psmd8
Synonyms 6720456J22Rik; AA407360; AL033291; AL033322; AL033323; C76433
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>BC004075
Red=Cloning site Blue=ORF Green=Tags(s)

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGTACGAGCAACTCAAGGACGAGTGGAACCGGAAGAGCCCGAACCTTAGTAAATGTGGAGAAGAACTGG
GCCGCCTGAAGTTGGTTCTGCTTGAGCTCAATTTCCTGCCAACCACGGGGACCAAACTGACTAAACAGCA
ACTCATTCTGGCCCGTGACATTCTGGAGATCGGGGCCCAGTGGAGCATCCTGTGCAAAGACATTCCCTCC
TTCGAGCGCTACATGGCCCAACTCAAATGCTACTACTTTGATTACAAAGAACAGCTTCCTGAGTCAGCCT
ATATGCACCAGCTCCTGGGCCTCAATCTCCTCTTCCTGCTATCTCAGAACCGAGTGGCTGAGTTCCACAC
AGAATTAGAACGATTACCTGCCAAGGACATCCAGACCAATGTCTACATCAAACACCCTGTTTCCCTCGAG
CAATACCTCATGGAGGGTAGCTACAACAAGGTATTCCTGGCTAAGGGGAACATCCCTGCCGAAAGCTACA
CCTTCTTCATTGACATCCTGCTGGATACCATCAGGGATGAAATCGCAGGATGCATTGAGAAGGCCTATGA
GAAAATCCTTTTTGCTGAGGCTACCCGGATCCTCTTCTTCAGCACACCCAAAAAGATGACAGACTATGCC
AAGAAGCGAGGTTGGGTGCTGGGCCCTAACAACTACTACAGCTTTGCCAGCCAGCAGCAGAAGCCAGAAG
ACAGCACCATCCCCTCTACTGAACTGGCCAAACAAGTCATCGAGTATGCCCGGCAGCTGGAGATGATTGT
CTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCTGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI |
ACCN BC004075
Insert Size 774 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq BC004075, AAH04075
RefSeq Size 1284 bp
RefSeq ORF 773 bp
Locus ID 57296
Cytogenetics 7 B1
Summary Component of the 26S proteasome, a multiprotein complex involved in the ATP-dependent degradation of ubiquitinated proteins. This complex plays a key role in the maintenance of protein homeostasis by removing misfolded or damaged proteins, which could impair cellular functions, and by removing proteins whose functions are no longer required. Therefore, the proteasome participates in numerous cellular processes, including cell cycle progression, apoptosis, or DNA damage repair.UniProtKB/Swiss-Prot Function
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"BC004075" in other vectors (4)
SKU Description Size Price
MG203305 Psmd8 (tGFP-tagged) - Mouse proteasome (prosome, macropain) 26S subunit, non-ATPase, 8 (cDNA clone MGC:8242 IMAGE:3591796), complete 10 ug
$500.00
MR203305 Psmd8 (Myc-DDK-tagged) - Mouse proteasome (prosome, macropain) 26S subunit, non-ATPase, 8 (cDNA clone MGC:8242 IMAGE:3591796), complete 10 ug
$289.00 $300.00
MR203305L3 Lenti ORF clone of Psmd8 (Myc-DDK-tagged) - Mouse proteasome (prosome, macropain) 26S subunit, non-ATPase, 8 (cDNA clone MGC:8242 IMAGE:3591796), complete 10 ug
$600.00
MR203305L4 Lenti ORF clone of Psmd8 (mGFP-tagged) - Mouse proteasome (prosome, macropain) 26S subunit, non-ATPase, 8 (cDNA clone MGC:8242 IMAGE:3591796), complete 10 ug
$600.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products