OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

Il1r2 (BC032962) Mouse Untagged Clone

Be the first to review this product
SKU
MC218190
Il1r2 (untagged) - Mouse interleukin 1 receptor, type II (cDNA clone MGC:41170 IMAGE:1282531), (10ug)
Interest in protein/lysate? Submit request here!
ORF Plasmid:
Tag Free tGFP DDK
AAV Particle:
DDK
  $330.00
3 Weeks*
Bulk Requests & Clone Modifications

Frequently Bought Together (3)

CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "Il1r2 or BC032962"

Specifications
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Il1r2
Synonyms CD121b; Il1r-2
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>BC032962
Red=Cloning site Blue=ORF Green=Tags(s)

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGTCTGTGGAACTCAAGGTCTTTAAGAATACTGAAGCATCTCTGCCTCATGTCTCCTACTTGCAAATCT
CAGCTCTCTCCACCACCGGGTTACTAGTGTGCCCTGACCTGAAAGAATTCATCTCCAGCAACGCTGATGG
AAAGATACAGTGGTATAAGGGCGCCATACTCTTGGATAAAGGCAATAAGGAATTTCTGAGTGCAGGAGAC
CCCACACGCCTATTGATATCCAACACGTCCATGGACGATGCAGGCTATTACAGATGTGTTATGACATTTA
CCTACAATGGCCAGGAATACAACATCACTAGGAATATTGAACTCCGGGTCAAAGGAACAACCACGGAACC
CATCCCTGTGATCATTTCTCCCCTGGAGACAATACCAGCATCATTGGGGTCAAGACTGATAGTCCCGTGC
AAAGTGTTTCTGGGAACTGGTACATCTTCCAACACCATTGTGTGGTGGTTGGCTAACAGCACGTTTATCT
CGGCTGCTTACCCAAGAGGCCGTGTGACCGAGGGGCTACACCCCCAGTACTCAGAGAATGATGAAAACTA
TGTGGAAGTGTCGCTGATTTTTGATCCAGTCACAAGGGAGGATCTGCATACAGATTTTAAATGTGTTGCC
TCGAATCCACGGAGTTCTCAGTCACTCCATACCACAGTCAAAGAAGTCTCTTCCACGTTCTCCTGGAGCA
TTGCGCTGGCACCTCTGTCTCTGATCATCTTGGTTGTGGGGGCAATATGGATGCGCAGACGGTGTAAACG
CAGGGCTGGAAAGACATATGGACTGACCAAGCTACGGACTGACAACCAGGACTTCCCTTCCAGCCCAAAC
TAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCTGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI |
ACCN BC032962
Insert Size 843 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq BC032962, AAH32962
RefSeq Size 1096 bp
RefSeq ORF 842 bp
Locus ID 16178
Cytogenetics 1 18.65 cM
Summary Non-signaling receptor for IL1A, IL1B and IL1RN. Reduces IL1B activities. Serves as a decoy receptor by competetive binding to IL1B and preventing its binding to IL1R1. Also modulates cellular response through non-signaling association with IL1RAP after binding to IL1B. IL1R2 (membrane and secreted forms) preferentially binds IL1B and poorly IL1A and IL1RN. The secreted IL1R2 recruits secreted IL1RAP with high affinity; this complex formation may be the dominant mechanism for neutralization of IL1B by secreted/soluble receptors (By similarity).UniProtKB/Swiss-Prot Function
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"BC032962" in other vectors (4)
SKU Description Size Price
MG203789 Il1r2 (tGFP-tagged) - Mouse interleukin 1 receptor, type II (cDNA clone MGC:41170 IMAGE:1282531) 10 ug
$489.00 $500.00
MR203789 Il1r2 (Myc-DDK-tagged) - Mouse interleukin 1 receptor, type II (cDNA clone MGC:41170 IMAGE:1282531) 10 ug
$289.00 $300.00
MR203789L3 Lenti ORF clone of Il1r2 (Myc-DDK-tagged) - Mouse interleukin 1 receptor, type II (cDNA clone MGC:41170 IMAGE:1282531) 10 ug
$600.00
MR203789L4 Lenti ORF clone of Il1r2 (mGFP-tagged) - Mouse interleukin 1 receptor, type II (cDNA clone MGC:41170 IMAGE:1282531) 10 ug
$600.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products