OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

Dkc1 (NM_001030307) Mouse Untagged Clone

Be the first to review this product
SKU
MC217214
Dkc1 (untagged) - Mouse dyskeratosis congenita 1, dyskerin homolog (human) (Dkc1), (10ug)
Interest in protein/lysate? Submit request here!
ORF Plasmid:
Tag Free tGFP DDK
  $759.00
4 Weeks*
Bulk Requests & Clone Modifications

Frequently Bought Together (3)

TA363075 DKC1 Antibody - middle region
100 ul
$585.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "Dkc1 or NM_001030307"

Specifications
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Dkc1
Synonyms BC068171
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>MC217214 representing NM_001030307
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCGGATGCAGAAGTAATTACATTCCCAAAGAAGCATAAGAAGAAAAAAGACCGGAAGCCATTACAAG
AAGATGATGTTGCCGAAATACAACATGCTGAAGAATTTCTTATCAAACCAGAATCTAAAGTGGCTCAATT
AGACACTTCTCAGTGGCCCTTGTTACTAAAGAATTTTGATAAGCTAAATGTAAGGACAGCACACTATACA
CCTCTTCCTTGTGGTTCAAATCCTCTGAAGAGGGAGATTGGGGACTATATCAGGACCGGTTTCATTAATC
TTGACAAGCCCTCTAACCCCTCTTCCCATGAGGTGGTAGCCTGGATCCGACGAATACTTCGGGTAGAGAA
GACTGGCCACAGTGGCACACTAGATCCCAAAGTGACTGGTTGTTTAATTGTGTGCATTGAACGAGCCACT
CGTTTGGTGAAATCACAACAGAGTGCAGGCAAAGAGTATGTTGGAATTGTCCGGCTGCACAATGCTATTG
AAGGGGGTACTCAGCTTTCTAGGGCCCTAGAAACTCTGACAGGTGCCCTGTTTCAGCGACCCCCACTTAT
TGCTGCAGTAAAGAGGCAGCTTCGAGTGAGGACTATCTACGAGAGCAAAATGATAGAATATGATCCTGAG
AGAAGATTAGGAATCTTTTGGGTAAGCTGTGAAGCTGGCACCTACATTCGGACACTATGCGTACACCTTG
GCTTGTTACTGGGAGTTGGTGGTCAGATGCAGGAACTTCGGAGGGTGCGTTCTGGAGTCATGAGTGAAAA
GGACCACATGGTGACAATGCATGATGTACTCGATGCTCAGTGGCTGTATGATAACCATAAGGATGAGAGT
TACTTGCGGCGTGTTGTTTACCCTTTGGAAAAGCTGTTGACATCTCATAAACGTCTGGTTATGAAAGATA
GTGCAGTGAATGCAATCTGCTATGGGGCCAAGATCATGCTTCCTGGTCTTCTTCGATATGAAGATGGCAT
TGAGGTCAACCAGGAGATTGTGGTCATTACTACTAAGGGGGAAGCTATCTGCATGGCAATTGCATTGATG
ACTACAGCAGTGATTTCTACCTGTGACCATGGTATAGTAGCCAAAATAAAGAGGGTGATCATGGAGAGAG
ACACTTATCCTCGCAAGTGGGGTTTAGGTCCAAAGGCAAGTCAGAAGAAGATGATGATCAAGCAGGGCCT
TCTGGACAAGCATGGCAAACCCACAGACAATACCCCTGCCACATGGAAACAGGATTACATTGACTATAGT
GATTCTGGCAAGAACACACTGGTTACCGAAGCAGTACAAGCCCCTCAGTTAGCTGCTGAAGCAGTAAATG
TCATAAAAAGGAAGCGGGATAGTGAGAGTGAAAGTGATGAGACCCCAACAGTTCCCCAGTTGAAGGAAAA
GAAGAAGAAGAAGGATAAGAAGCCCAAAACTGTGCTAGAAAGTGGGGGCGAAACTGGAGATGGGGACAAC
GACACCACCAAAAAGAAAAAGAAGAAGAAAGTAAAAGTGGTAGAAGAGATGTCTGAATAG

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI |
ACCN NM_001030307
Insert Size 1530 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001030307.2, NP_001025478.1
RefSeq Size 2803 bp
RefSeq ORF 1530 bp
Locus ID 245474
UniProt ID Q9ESX5
Cytogenetics X A7.3
Summary Catalytic subunit of H/ACA small nucleolar ribonucleoprotein (H/ACA snoRNP) complex, which catalyzes pseudouridylation of rRNA (PubMed:12522253, PubMed:15240872). This involves the isomerization of uridine such that the ribose is subsequently attached to C5, instead of the normal N1. Each rRNA can contain up to 100 pseudouridine ('psi') residues, which may serve to stabilize the conformation of rRNAs (PubMed:12522253, PubMed:15240872). Required for ribosome biogenesis and telomere maintenance (By similarity). Also required for correct processing or intranuclear trafficking of TERC, the RNA component of the telomerase reverse transcriptase (TERT) holoenzyme (By similarity).UniProtKB/Swiss-Prot Function
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_001030307" in other vectors (4)
SKU Description Size Price
MG208185 Dkc1 (tGFP-tagged) - Mouse dyskeratosis congenita 1, dyskerin homolog (human) (Dkc1) 10 ug
$958.00
MR208185 Dkc1 (Myc-DDK-tagged) - Mouse dyskeratosis congenita 1, dyskerin homolog (human) (Dkc1) 10 ug
$758.00
MR208185L3 Lenti ORF clone of Dkc1 (Myc-DDK-tagged) - Mouse dyskeratosis congenita 1, dyskerin homolog (human) (Dkc1) 10 ug
$1,058.00
MR208185L4 Lenti ORF clone of Dkc1 (mGFP-tagged) - Mouse dyskeratosis congenita 1, dyskerin homolog (human) (Dkc1) 10 ug
$1,058.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products