Dcstamp (NM_029422) Mouse Untagged Clone

SKU
MC216530
Dcstamp (untagged) - Mouse transmembrane 7 superfamily member 4 (Tm7sf4), (10ug)
$732.00
3 Weeks*
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Dcstamp
Synonyms 4833414I07Rik; DC-STAMP; FIND; mDC-STAMP; Tm7sf4
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>MC216530 representing NM_029422
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGAGGCTCTGGACCTTGGGCACCAGTATTTTCCTGAGGCTTTGGGGGACTTATGTGTTTCCACGAAGCC
CTAGCTGGCTGGACTTCATCCAGCATTTGGGAGTCTGTTGCTTTGTGGCCTTCCTTTCGGTGAGCCTCTT
CTCTGCAGCCTTTTACTGGATCCTGCCACCCGTTGCCCTGCTCTCTTCTGTCTGGATGATCACCTGTGTT
TTCCTATGCTGTTCCAAGCGCGCACGATGCTTCATTCTTCTGGCCGTTCTGTCGTGTGGCCTCCGTGAAG
GTAGGAACGCTTTGATTGCGGCTGGCACTGGGGTAGTGATCTTTGGACATGTGGAAAATATTTTTTATAA
CTTCAGAGGTCTCCTAGACAGCATGACTTGCAACCTAAGGGCAAAGAGCTTTTCAGTACATTTCCCACTT
TTAAAACGGTATACTGAAGCCATCCAGTGGATTTACGGCCTTGCCACTCCGCTGAATCTATTTGATGACC
TTGTTTCTTGGAACCAGACTCTGGTGGTCTCTCTTTTTAGTCCCAGCCATGCCCTGGAGGCTCATATGAA
TGACACTAGAGGAGAAGTCCTGGGAGTCCTGCACCATATGGTGGTCACGACAGAGCTGTTGACTTCCGTG
GGCCAGAAGTTGCTTGCCCTTGCCGGGCTTCTGCTCATCCTAGTCAGCACTGGCCTCTTCCTGAAGCGAT
TCCTGGGCCCTTGTGGCTGGAAGTATGAGAATGTCTACATCACCAAACAATTTGTTCGGTTTGATGAAAA
GGAGAGGCACCAACAGCGGCCCTGTGTCCTCCCGCTGAATAAGAAGGAAAGGAAGAAATATGTCATCGTC
CCATCTTTGCAGCTGACTCCTAAGGAGAAGAAAACCCTTGGGCTGTTCTTCCTTCCTGTCCTGACCTATC
TCTACATGTGGGTGCTGTTTGCCGCTGTGGACTATCTGCTGTATCGGCTCATCTCCTCCATGAACAAACA
GTTCCAAAGCTTGCCAGGGCTGGAAGTTCACTTGAAACTACGTGGAGAGAAGCAAGGAACCCAAGGAGTC
GTCCATGATTCTGCCTTTAATATATCTATGTTTGAACCGAGCTGCATTCCTAAACCACGTCTCAGTGTGT
CTGAGACTTGGGTTCCTCTCAGTATTATTCTGTTAACACTAATAATACTAGGATTGTTGTCTTCTATGCT
GATGCAGCTTAAAATTCTCGTGTCAGTCTCCTTCTACCCCAAAGTGGAGAGGGAGAGAATTGAATACCTG
CATGCGAAGCTCCTTGAGAAACGATCAAAGCAGCCATTGAGAGAGGCTGACGGGAAACCGAGCCTGTACT
TTAAAAAGATTCATTTCTGGTTTCCAGTCCTGAAAATGATTAGGAAGAAGCAGACAATCCCTGCAAATGA
AGATGATCTATGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI
ACCN NM_029422
Insert Size 1413 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_029422.4, NP_083698.1
RefSeq Size 1999 bp
RefSeq ORF 1413 bp
Locus ID 75766
UniProt ID Q7TNJ0
Cytogenetics 15 B3.1
Summary Probable cell surface receptor that plays several roles in cellular fusion, cell differentiation, bone and immune homeostasis. Plays a role in TNFSF11-mediated osteoclastogenesis. Cooperates with OCSTAMP in modulating cell-cell fusion in both osteoclasts and foreign body giant cells (FBGCs). Participates in osteoclast bone resorption. Involved in inducing the expression of tartrate-resistant acid phosphatase in osteoclast precursors. Plays a role in haematopoietic stem cell differentiation of bone marrow cells toward the myeloid lineage. Inhibits the development of neutrophilic granulocytes. Plays also a role in the regulation of dendritic cell (DC) antigen presentation activity by controlling phagocytic activity. Involved in the maintenance of immune self-tolerance and avoidance of autoimmune reactions.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (1) represents the longest transcript and encodes the longest isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
Write Your Own Review
You're reviewing:Dcstamp (NM_029422) Mouse Untagged Clone
Your Rating
SKU Description Size Price
MG224544 Dcstamp (tGFP-tagged) - Mouse transmembrane 7 superfamily member 4 (Tm7sf4), (10ug) 10 ug
$886.00
MR224544 Dcstamp (Myc-DDK-tagged) - Mouse transmembrane 7 superfamily member 4 (Tm7sf4) 10 ug
$686.00
MR224544L3 Lenti ORF clone of Dcstamp (Myc-DDK-tagged) - Mouse transmembrane 7 superfamily member 4 (Tm7sf4) 10 ug
$986.00
MR224544L4 Lenti ORF clone of Dcstamp (mGFP-tagged) - Mouse transmembrane 7 superfamily member 4 (Tm7sf4) 10 ug
$986.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.