OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

Gpr119 (NM_181751) Mouse Untagged Clone

Be the first to review this product
SKU
MC213024
Gpr119 (untagged) - Mouse G-protein coupled receptor 119 (Gpr119), (10ug)
Interest in protein/lysate? Submit request here!
ORF Plasmid:
Tag Free tGFP DDK
AAV Particle:
DDK
  $457.00
In Stock*
Bulk Requests & Clone Modifications

Frequently Bought Together (3)

CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "Gpr119 or NM_181751"

Specifications
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Gpr119
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>MC213024 representing NM_181751
Red=Cloning site Blue=ORF Green=Tags(s)

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC



ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Chromatograms Chromatograms
Sequencher program is needed, download here
Restriction Sites SgfI-MluI |
ACCN NM_181751
Insert Size 1008 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_181751.2, NP_861416.1
RefSeq Size 2278 bp
RefSeq ORF 1008 bp
Locus ID 236781
UniProt ID Q7TQP3
Cytogenetics X A5
Summary Receptor for the endogenous fatty-acid ethanolamide oleoylethanolamide (OEA) and lysophosphatidylcholine (LPC). Functions as a glucose-dependent insulinotropic receptor. The activity of this receptor is mediated by G proteins which activate adenylate cyclase. Seems to act through a G(s) mediated pathway.UniProtKB/Swiss-Prot Function
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_181751" in other vectors (4)
SKU Description Size Price
MG224908 Gpr119 (tGFP-tagged) - Mouse G-protein coupled receptor 119 (Gpr119), (10ug) 10 ug
$657.00
MR224908 Gpr119 (Myc-DDK-tagged) - Mouse G-protein coupled receptor 119 (Gpr119) 10 ug
$289.00 $457.00
MR224908L3 Lenti ORF clone of Gpr119 (Myc-DDK-tagged) - Mouse G-protein coupled receptor 119 (Gpr119) 10 ug
$757.00
MR224908L4 Lenti ORF clone of Gpr119 (mGFP-tagged) - Mouse G-protein coupled receptor 119 (Gpr119) 10 ug
$757.00

file-alt Citations

GPR119 agonist AS1269574 activates TRPA1 cation channels to stimulate GLP-1 secretion
Chepurny, Holz, Roe et al
Mol. Endocrinol. (2016)
Cited by 27
AI Summary: OriGene contributed to this study by providing the mouse GPR119 cDNA in the pCMV6-Entry plasmid, which was used to investigate the effects of AS1269574 on GPR119-mediated signaling pathways.
Snippet: Wild-type and C622S rat TRPA1 channel expression plasmids were from Prof. ER Liman (University of Southern California, Los Angeles, CA). Mouse GPR119 cDNA (GenBank NM 181741) in plas- mid pCMV6-Entry was from OriGene (Rockville, MD). ... Cite SaveSaving
Stimulation of proglucagon gene expression by human GPR119 in enteroendocrine L-cell line GLUTag
Chepurny, Bertinetti, Diskar et al
Mol. Endocrinol. (2013) 27 (8), 1267-82 DOI: 10.1210/me.2013-1029
Cited by 35
AI Summary: OriGene's human GPR119 cDNA (GenBank NM_181751) in the pCMV6-Entry vector was used to transfect GLUTag cells, enabling the study of hGPR119’s effects on proglucagon gene expression in this research.
Snippet: cDNA (GenBank NM_181751) in pCMV6-Entry vector was from OriGene Tech (Rockville, Maryland). Transient transfections with these plasmids were performed using Lipofectamine and Plus reagent according to the manufacturer's protocol (Invitrogen Life Technologies).
Showing 1-2 of 2 papers.
Powered by BizGenius
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products