Npy (NM_023456) Mouse Untagged Clone

SKU
MC212210
Npy (untagged) - Mouse neuropeptide Y (Npy), (10ug)
  $150.00
In Stock*
Specifications
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Npy
Synonyms 0710005A05Rik
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>NCBI ORF sequence for NM_023456, the custom clone sequence may differ by one or more nucleotides


ATGCTAGGTAACAAGCGAATGGGGCTGTGTGGACTGACCCTCGCTCTATCTCTGCTCGTGTGTTTGGGCA
TTCTGGCTGAGGGGTACCCCTCCAAGCCGGACAATCCGGGCGAGGACGCGCCAGCAGAGGACATGGCCAG
ATACTACTCCGCTCTGCGACACTACATCAATCTCATCACCAGACAGAGATATGGCAAGAGATCCAGCCCT
GAGACACTGATTTCAGACCTCTTAATGAAGGAAAGCACAGAAAACGCCCCCAGAACAAGGCTTGAAGACC
CTTCCATGTGGTGA


Restriction Sites SgfI-MluI |
ACCN NM_023456
Insert Size 294 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq BC043012, AAH43012
RefSeq Size 561 bp
RefSeq ORF 294 bp
Locus ID 109648
UniProt ID P57774
Cytogenetics 6 24.04 cM
Summary This gene encodes a neuropeptide that plays a pivotal role in many physiological functions such as food intake, energy homeostasis, circadian rhythm, and cognition. The encoded protein precursor undergoes proteolytic processing to generate the biologically active peptide. Mice lacking the encoded protein exhibit mild seizures occasionally and become hyperphagic following food deprivation. A deficiency of the encoded protein partially prevents mice lacking leptin from becoming obese. provided by RefSeq, Oct 2015
Reviews
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_023456" in other vectors (4)
SKU Description Size Price
MG226370 Npy (tGFP-tagged) - Mouse neuropeptide Y (Npy), (10ug) 10 ug
$489.00
MR226370 Npy (Myc-DDK-tagged) - Mouse neuropeptide Y (Npy) 10 ug
$289.00
MR226370L3 Lenti ORF clone of Npy (Myc-DDK-tagged) - Mouse neuropeptide Y (Npy) 10 ug
$450.00
MR226370L4 Lenti ORF clone of Npy (mGFP-tagged) - Mouse neuropeptide Y (Npy) 10 ug
$450.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products