Tac4 (NM_053093) Mouse Untagged Clone

SKU
MC211978
Tac4 (untagged) - Mouse tachykinin 4 (Tac4), (10ug)
  $165.00
2 Weeks*
Specifications
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Tac4
Synonyms AW489379; PPT-C
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>MC211978 representing NM_053093
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGTTGCCTCTCCTTGCCCTGCTTCTCCTGATCGGGCCATCAGTGTGCACTACAGCAGGAGACAGAGAGG
AACTGGCTTTTGGTGCAGAGGCAGAGTCCTGGGTGACCGTGAACCTGAAGGGAATCCCCGTCCCCAGCAT
TGAACTTAAGCTTCAGGAGTTGAAGAGAAGCAGGACTCGCCAGTTCTATGGTCTGATGGGGAAGCGGGTG
GGAGGGTATCAGCTGGGACGTATAGTGCAGGATCTCCTTGGCACGAGAGGTTTGTCCATAGAAGGGACCT
GCAGACAGGCGGCGAGTCAACAGAGGGCACGACCCGGAGCAGTGACCAGAGAAAGCCTCCAGAGTCGAGA
GGAAGATGAGGCTCCCCTAACCACCAGCAACGTGTAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI |
ACCN NM_053093
Insert Size 387 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_053093.1, NP_444323.1
RefSeq Size 1248 bp
RefSeq ORF 387 bp
Locus ID 93670
UniProt ID Q99N14
Cytogenetics 11 D
Summary Tachykinins are active peptides which excite neurons, evoke behavioral responses, are potent vasodilators and secretagogues, and contract (directly or indirectly) many smooth muscles. Hemokinin induces plasma extravasation, mast cell degranulation, muscle contraction, salivary secretion and scratching behavior. Increases sperm motility. Induces potent analgesic effects and may play a role in pain modulation. Promotes survival of bone marrow B lineage cells and of cultured LPS-stimulated pre-B cells and may act as an autocrine factor required for B-cell survival and proliferation. Lowers systemic arterial pressure following intravenous injection. Induces interferon-gamma production and may play a role in the inflammatory response. Shows potent affinity and specificity for the NK-1 receptor.UniProtKB/Swiss-Prot Function
Reviews
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_053093" in other vectors (4)
SKU Description Size Price
MG222957 Tac4 (tGFP-tagged) - Mouse tachykinin 4 (Tac4), (10ug) 10 ug
$350.00
MR222957 Tac4 (Myc-DDK-tagged) - Mouse tachykinin 4 (Tac4) 10 ug
$289.00
MR222957L3 Lenti ORF clone of Tac4 (Myc-DDK-tagged) - Mouse tachykinin 4 (Tac4) 10 ug
$450.00
MR222957L4 Lenti ORF clone of Tac4 (mGFP-tagged) - Mouse tachykinin 4 (Tac4) 10 ug
$450.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products