OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

Kcnip2 (NM_145703) Mouse Untagged Clone

Be the first to review this product
SKU
MC211934
Kcnip2 (untagged) - Mouse Kv channel-interacting protein 2 (Kcnip2), transcript variant a, (10ug)
Interest in protein/lysate? Submit request here!
ORF Plasmid:
Tag Free tGFP DDK
AAV Particle:
DDK
  $300.00
In Stock*
Bulk Requests & Clone Modifications

Frequently Bought Together (3)

CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "Kcnip2 or NM_145703"

Specifications
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Kcnip2
Synonyms KChI; KChIP2
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>MC211934 representing NM_145703
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGCGGGGCCAAGGCCGAAAGGAGAGTTTGTCCGAATCCCGAGATTTGGACGGCTCCTATGACCAGCTTA
CGGGCCACCCTCCAGGGCCCAGTAAAAAAGCCCTGAAGCAGCGTTTCCTCAAGCTGCTGCCGTGCTGCGG
GCCCCAAGCCCTGCCCTCAGTCAGTGAAACATTAGCTGCCCCAGCCTCCCTCCGCCCCCACAGACCCCGC
CCGCTGGACCCAGACAGCGTGGAGGATGAGTTTGAACTATCCACGGTGTGCCACCGGCCTGAGGGTCTGG
AACAACTCCAGGAACAAACCAAGTTCACACGCAGAGAGTTGCAGGTCCTGTACAGAGGCTTCAAGAACGA
ATGTCCCAGCGGAATTGTCAACGAGGAGAACTTCAAGCAAATTTATTCTCAGTTCTTTCCCCAAGGAGAC
TCCAGCAACTACGCTACTTTTCTCTTCAATGCCTTTGACACCAACCATGATGGCTCTGTCAGTTTTGAGG
ACTTTGTGGCTGGTTTGTCAGTGATTCTTCGGGGAACCATAGATGATAGACTGAACTGGGCTTTCAACTT
ATATGACCTCAACAAGGATGGCTGTATCACGAAGGAGGAAATGCTCGACATCATGAAGTCCATCTATGAC
ATGATGGGCAAGTACACCTACCCTGCCCTCCGGGAGGAGGCCCCGAGGGAACACGTGGAGAGCTTCTTCC
AGAAGATGGACAGAAACAAGGACGGCGTGGTGACCATTGAGGAATTCATTGAGTCTTGTCAACAGGACGA
GAACATCATGAGGTCCATGCAACTCTTTGATAATGTCATCTAG

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Chromatograms Chromatograms
Sequencher program is needed, download here
Restriction Sites SgfI-MluI |
ACCN NM_145703
Insert Size 813 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_145703.2, NP_663749.1
RefSeq Size 2414 bp
RefSeq ORF 813 bp
Locus ID 80906
UniProt ID Q9JJ69
Cytogenetics 19 38.75 cM
Summary This gene encodes a member of the voltage-gated potassium channel-interacting protein (KCNIP) family. KCNIP family members are small calcium binding proteins that commonly exhibit unique variation at their N-termini, and which modulate A-type potassium channels. This gene is predominantly expressed in the adult heart, and to a lesser extent in the brain. Disruption of this gene is associated with susceptibility to cardiac arrhythmias and lack of transient outward potassium current in ventricular myocytes, and downregulated expression is associated with cardiac hypertrophy. The encoded protein has also been implicated as a repressor of immune response. Alternative splicing results in multiple transcript variants. provided by RefSeq, Feb 2013
Transcript Variant: This variant (a) represents the longest transcript and encodes the longest isoform (a, also known as KCHIP2L).
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_145703" in other vectors (4)
SKU Description Size Price
MG223165 Kcnip2 (tGFP-tagged) - Mouse Kv channel-interacting protein 2 (Kcnip2) transcript variant a, (10ug) 10 ug
$500.00
MR223165 Kcnip2 (Myc-DDK-tagged) - Mouse Kv channel-interacting protein 2 (Kcnip2), transcript variant a 10 ug
$289.00 $300.00
MR223165L3 Lenti ORF clone of Kcnip2 (Myc-DDK-tagged) - Mouse Kv channel-interacting protein 2 (Kcnip2), transcript variant a 10 ug
$600.00
MR223165L4 Lenti ORF clone of Kcnip2 (mGFP-tagged) - Mouse Kv channel-interacting protein 2 (Kcnip2), transcript variant a 10 ug
$600.00

file-alt Citations

A novel bungarotoxin binding site-tagged construct reveals MAPK-dependent Kv4.2 trafficking
Tabor, Park, Murphy et al
Mol. Cell. Neurosci. (2019) 98, 121-130 DOI: 10.1016/j.mcn.2019.06.007
AI Summary: OriGene’s pCMV6-hKv4.2-myc-DDK (FLAG) construct was used as the backbone for creating the novel bungarotoxin binding site-tagged Kv4.2 channel, enabling the study of Kv4.2 trafficking and localization described in this paper.
Snippet: HAP1 bungarotoxin binding site (BBS), flanked by two glycine residues (GG-WRYYESSLLPYPD-GG), was inserted into various locations in the extracellular S1-S2 and S3-S4 linker regions of an existing pCMV6-hKv4.2-myc-DDK (FLAG) construct (Origene
A polybasic motif in alternatively spliced KChIP2 isoforms prevents Ca2+ regulation of Kv4 channels
Murphy, Hoffman
J. Biol. Chem. (2019)
AI Summary: OriGene products—specifically Human Kv4.1 (RC207353), Kv4.2 (RC215266), and Kv4.3 (RC219447) expression vectors—were used to heterologously express Kv4 channels in HEK293T cells, enabling the study of Ca2+ regulation of KChIP-Kv4 channel complexes in this paper.
Snippet: Experimental Procedures Mammalian Expression Vectors Heterologous Kv4 channel expression was carried out using Human Kv4.1 (RC207353), Kv4.2 (RC215266), and Kv4.3 (RC219447) (Origene) 6 Page 7. Ca2+ regulation of KChIP-Kv4 channel complexes from
Showing 1-2 of 2 papers.
Powered by BizGenius
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products