Cd200r3 (NM_001128132) Mouse Untagged Clone

SKU
MC211541
Cd200r3 (untagged) - Mouse CD200 receptor 3 (Cd200r3), transcript variant 1, (10ug)
  $300.00
In Stock*
Specifications
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Cd200r3
Synonyms 4733401I18Rik; 4833409J19Rik; AI505817; BB106877; mCD200RLb
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>MC211541 representing NM_001128132
Red=Cloning site Blue=ORF Green=Tags(s)

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC



ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAG
GTTTAA
Chromatograms Chromatograms
Sequencher program is needed, download here
Restriction Sites SgfI-MluI |
ACCN NM_001128132
Insert Size 837 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001128132.1, NP_001121604.1
RefSeq Size 1622 bp
RefSeq ORF 837 bp
Locus ID 74603
UniProt ID Q5UKY4
Cytogenetics 16 B4- B5
Summary According to PubMed:15187158 isoform 4 is a receptor for the CD200 cell surface glycoprotein. According to PubMed:16081818 isoform 4 is not a receptor for the CD200/OX2 cell surface glycoprotein. Isoform 1, isoform 2 and isoform 3 are involved in the recruitment or surface expression of the TYROBP receptor. Isoform 6, isoform 7 and isoform 8 are not involved in the recruitment or surface expression of the TYROBP receptor.UniProtKB/Swiss-Prot Function
Transcript Variant: This variant (1) represents the longest transcript and encodes the longest isoform (1). Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments.
Reviews
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_001128132" in other vectors (4)
SKU Description Size Price
MG218430 Cd200r3 (tGFP-tagged) - Mouse CD200 receptor 3 (Cd200r3) transcript variant 1, (10ug) 10 ug
$489.00 $530.00
MR218430 Cd200r3 (Myc-DDK-tagged) - Mouse CD200 receptor 3 (Cd200r3), transcript variant 1 10 ug
$330.00
MR218430L3 Lenti ORF clone of Cd200r3 (Myc-DDK-tagged) - Mouse CD200 receptor 3 (Cd200r3), transcript variant 1 10 ug
$630.00
MR218430L4 Lenti ORF clone of Cd200r3 (mGFP-tagged) - Mouse CD200 receptor 3 (Cd200r3), transcript variant 1 10 ug
$630.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products