OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

Med27 (NM_026896) Mouse Untagged Clone

Be the first to review this product
SKU
MC210834
Med27 (untagged) - Mouse mediator complex subunit 27 (Med27), (10ug)
Interest in protein/lysate? Submit request here!
ORF Plasmid:
Tag Free tGFP DDK
AAV Particle:
DDK
  $330.00
3 Weeks*
Bulk Requests & Clone Modifications

Frequently Bought Together (3)

CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "Med27 or NM_026896"

Specifications
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Med27
Synonyms 1500015J03Rik; 2310042P07Rik; AA682045; Crsp8; D2Ertd434e
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>MC210834 representing NM_026896
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCGGACGTGCTGAGCGTTGGTGTGAACCTGGAGGCCTTTTCGCAGGCTATTAGCGCCATCCAGGCGC
TACGCTCTAGCGTGAGTAGGGTCTTCGACTGCCTTAAGGATGGCATGCGCAACAAAGAGACGCTGGAGGG
CCGCGAGAAGGCCTTCATCGCGAACTTCCAGGACAACTTGCATTCCGTCAACCGGGACCTCAATGAACTG
GAACGTTTGAGCAACCTGGTAGGCAAGCCGTCTGAGAACCACCCTCTTCATAACAGTGGGCTGCTAAGCC
TGGATCCTGTGCAGGACAAAACCCCACTCTACAGCCAGCTTCTGCAAGCATACAAATGGTCCAACAAGCT
GCAGTACCATGCAGGTCTAGCGTCTGGCCTTTTGAACCAACAGTCCTTGAAGCGCTCTGCAAATCAGATG
GGTGTGTCTGCCAAGCGGAGACCGAAGGCCCAGCCCACCACTCTGGTTCTACCACCTCAGTATGTCGATG
ACGTGATCAGCCGCATTGACAGAATGTTTCCAGAGATGTCCATTCACTTATCGAGACCCAATGGGACTTC
AGCAATGCTTCTGGTGACCTTGGGGAAGGTGTTGAAAGTCATTGTGGTCATGAGGAGCCTGTTCATCGAT
CGCACGATTGTGAAGGGGTATAATGAGAGCGTCTACACAGAGGATGGAAAGCTGGACATATGGTCCAAAT
CCAGCTACCAAGTGTTCCAGAAGGTGACAGACCATGCCACCACTGCCCTGCTTCACTATCAGTTACCCCA
GATGCCAGACGTCGTGGTCAGGTCCTTCATGACCTGGCTGAGAAGCTACATTAAGCTGTTCCAGGCCCCG
TGCCAGCGCTGTGGGAAGTTTCTACAAGATGGCCTTCCCCCGACGTGGAGAGACTTCCGAACCCTGGAAG
CTTTCCATGACACCTGCCGACAGTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI |
ACCN NM_026896
Insert Size 936 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_026896.5, NP_081172.2
RefSeq Size 1276 bp
RefSeq ORF 936 bp
Locus ID 68975
UniProt ID Q9DB40
Cytogenetics 2 19.84 cM
Summary Component of the Mediator complex, a coactivator involved in the regulated transcription of nearly all RNA polymerase II-dependent genes. Mediator functions as a bridge to convey information from gene-specific regulatory proteins to the basal RNA polymerase II transcription machinery. Mediator is recruited to promoters by direct interactions with regulatory proteins and serves as a scaffold for the assembly of a functional preinitiation complex with RNA polymerase II and the general transcription factors (By similarity).UniProtKB/Swiss-Prot Function
Transcript Variant: This variant (1) encodes the longest isoform (a).
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_026896" in other vectors (4)
SKU Description Size Price
MG224500 Med27 (tGFP-tagged) - Mouse mediator complex subunit 27 (Med27), (10ug) 10 ug
$500.00
MR224500 Med27 (Myc-DDK-tagged) - Mouse mediator complex subunit 27 (Med27) 10 ug
$289.00 $300.00
MR224500L3 Lenti ORF clone of Med27 (Myc-DDK-tagged) - Mouse mediator complex subunit 27 (Med27) 10 ug
$600.00
MR224500L4 Lenti ORF clone of Med27 (mGFP-tagged) - Mouse mediator complex subunit 27 (Med27) 10 ug
$600.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products