Rchy1 (NM_026557) Mouse Untagged Clone

SKU
MC210687
Rchy1 (untagged) - Mouse ring finger and CHY zinc finger domain containing 1 (Rchy1), (10ug)
  $330.00
3 Weeks*
Specifications
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Rchy1
Synonyms ARNIP; CHIMP; Pi; Pirh2; PRO1; Zfp36; Zfp363; Znf363
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>MC210687 representing NM_026557
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCGGCGACGGCGCGGGAAGATGGCGTCCGCAACCTGGCGCAGGGGCCGCGGGGCTGCGAGCACTATG
ACAGAGCTTGTCTCCTCAAGGCACCTTGTTGTGACAAGCTTTATACCTGCCGGCTGTGTCACGATACCAA
TGAAGATCATCAGCTAGATCGTTTCAAAGTCAAGGAAGTGCAGTGCATCAACTGTGAAAAACTCCAACAT
GCCCAGCAGACTTGTGAAGACTGTAGCACATTGTTTGGAGAATATTACTGCAGTATTTGCCACCTGTTTG
ACAAAGATAAGAGGCAGTACCACTGTGAGAGCTGTGGGATTTGTAGGATTGGTCCAAAGGAAGATTTTTT
CCATTGCTTGAAATGTAATTTATGCCTAACCACGAATCTTCGAGGAAAACACAAGTGTATTGAAAATGTT
TCCCGGCAGAATTGTCCAATATGCTTGGAGGACATTCACACCTCCCGTGTTGTTGCTCACGTCTTGCCGT
GTGGGCATCTCCTACATAGAACGTGTTATGAAGAAATGTTGAAAGAAGGTTACAGATGCCCATTGTGTAT
GCATTCTGCCTTAGACATGACTCGGTACTGGAGACAACTAGATACTGAGGTAGCACAGACTCCCATGCCA
TCCGAATACCAGAACGTGACTGTTGACATTCTCTGCAATGACTGTAATGGACGATCCACAGTCCAGTTCC
ATATCTTAGGCATGAAATGTAAGCTTTGTGACTCCTACAATACTGCCCAAGCTGGAGGCCGTAGAGTGCC
AGTGGATCAGCAGTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI |
ACCN NM_026557
Insert Size 786 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_026557.4, NP_080833.1
RefSeq Size 2029 bp
RefSeq ORF 786 bp
Locus ID 68098
UniProt ID Q9CR50
Cytogenetics 5 E2
Summary This gene encodes a protein containing CHY-, CTCHY-, and RING-type zinc-fingers. The encoded protein functions as an E3 ubiquitin ligase, and mediates the degradation of target proteins such as p53. The activity of this protein is important in cell cycle regulation. Alternative splicing results in multiple transcript variants. provided by RefSeq, Nov 2012
Transcript Variant: This variant (1) represents the longest transcript and encodes the longer isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
Reviews
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_026557" in other vectors (5)
SKU Description Size Price
MG203426 Rchy1 (tGFP-tagged) - Mouse ring finger and CHY zinc finger domain containing 1 (Rchy1) 10 ug
$500.00
MR203406 Rchy1 (Myc-DDK-tagged) - Mouse ring finger and CHY zinc finger domain containing 1 (Rchy1) 10 ug
$289.00 $300.00
MR203406L3 Lenti ORF clone of Rchy1 (Myc-DDK-tagged) - Mouse ring finger and CHY zinc finger domain containing 1 (Rchy1) 10 ug
$600.00
MR203406L4 Lenti ORF clone of Rchy1 (mGFP-tagged) - Mouse ring finger and CHY zinc finger domain containing 1 (Rchy1) 10 ug
$600.00
MR203426 Rchy1 (Myc-DDK-tagged) - Mouse ring finger and CHY zinc finger domain containing 1 (Rchy1) 10 ug
$289.00 $300.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products