Cldn12 (NM_001193660) Mouse Untagged Clone

SKU
MC210234
Cldn12 (untagged) - Mouse claudin 12 (Cldn12), transcript variant 3, (10ug)
  $330.00
3 Weeks*
Specifications
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Cldn12
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>MC210234 representing NM_001193660
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGGCTGCCGAGATGTCCACGCAGCCACCGTCCTGTCCTTCCTGTGTGGTATTGCCTCTGTCGCAGGCC
TCTTTGCGGGGACTCTGCTTCCTAACTGGAGGAAACTGCGGCTGATCACATTCAACAGAAACGAGAAGAA
CCTGACGATTTACACGGGCCTGTGGGTGAAGTGTGCCCGGTATGATGGAAGCAGTGACTGCCTGATGTAC
GACCGTACGTGGTACCTGTCGGTTGACCAGCTGGACCTGCGTGTCCTCCAGTTTGCCCTGCCTCTCAGCA
TCGTGATCGCAATGGGTGCCTTGCTACTCTGCCTGATTGGAATGTGTAACACGGCCTTCAATTCTTCCGT
GCCTAACATCAAACTGGCCAAGTGTCTGGTCAATAGTGCAGGCTGCCACCTGGTGGCCGGACTCCTGTTT
TTTCTGGCAGGTACCGTGAGCCTCTCTCCGTCCATCTGGGCCATCTTTTATAACAGCCATCTCAACAGGA
AGTTTGAGCCGGTCTTTACCTTTGACTATGCAGTATTTGTCACTATTGCTAGCTCAGGGGGTCTGTTTAT
GACTGCTCTCCTGCTGTTCGTTTGGTATTGTGCATGCAAGTCTTTGTCCTCTCCTTTCTGGCAACCGCTG
TACTCTCACGCTCCCGGGATGCACACTTACTCACAGCCCTATTCATCACGGTCCCGCCTCTCTGCCATTG
AAATCGACATTCCAGTAGTCTCACACAGCACTTAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI |
ACCN NM_001193660
Insert Size 735 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001193660.1, NP_001180589.1
RefSeq Size 3752 bp
RefSeq ORF 735 bp
Locus ID 64945
UniProt ID Q9ET43
Cytogenetics 5 A1
Summary This gene encodes a member of the claudin family. Claudins are integral membrane proteins and components of tight junction strands. Tight junction strands serve as a physical barrier to prevent solutes and water from passing freely through the paracellular space between epithelial or endothelial cell sheets, and also play critical roles in maintaining cell polarity and signal transductions. This gene, along with several other family members, is expressed in the inner ear. The protein encoded by this gene and another family member, claudin 2, are critical for vitamin D-dependent Ca2+ absorption between enterocytes. Multiple alternatively spliced transcript variants encoding the same protein have been found. provided by RefSeq, Oct 2011
Transcript Variant: This variant (3) differs in the 5' UTR, as compared to variant 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
Reviews
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_001193660" in other vectors (4)
SKU Description Size Price
MG225328 Cldn12 (tGFP-tagged) - Mouse claudin 12 (Cldn12) transcript variant 3, (10ug) 10 ug
$500.00
MR225328 Cldn12 (Myc-DDK-tagged) - Mouse claudin 12 (Cldn12), transcript variant 3 10 ug
$289.00 $300.00
MR225328L3 Lenti ORF clone of Cldn12 (Myc-DDK-tagged) - Mouse claudin 12 (Cldn12), transcript variant 3 10 ug
$600.00
MR225328L4 Lenti ORF clone of Cldn12 (mGFP-tagged) - Mouse claudin 12 (Cldn12), transcript variant 3 10 ug
$600.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products