Morf4l2 (NM_001168225) Mouse Untagged Clone

SKU
MC210049
Morf4l2 (untagged) - Mouse mortality factor 4 like 2 (Morf4l2), transcript variant 2, (10ug)
  $330.00
3 Weeks*
Specifications
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Morf4l2
Synonyms 2410017O14Rik; mKIAA0026; Mrgx; Sid393p
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>MC210049 representing NM_001168225
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGAGTTCCAGAAAGCAGGCTTCTCAAACTCGTGGACAACAATCTGCTGAAGAAGACAACTTTAAGAAAC
CAACTCGAAGCAATATGCAGAGAAGTAAGATGAGAGGAGCTGCCTCGGGAAAGAAGTCAGCTGGTTCGCA
GCCAAAGAATCTCGATCCAGCCCTGCCCGGAAGATGGGGAGGTCGCTCTGCTGAGAACCCCCCTTCCGGT
TCTGTGCGGAAGACCAGGAAGAACAAGCAGAAGGCTCCTGGCAACGGAGACGGAGGCAGTACCAGTGAAG
TCCCCCAGCCCCCTCGGAAGAAAAGGGCACGGGCTGACCCCACTGTGGAGAGCGAGGAGGCATTCAAGAG
TAGGATGGAGGTGAAGGTGAAGATCCCTGAAGAATTAAAACCGTGGCTGGTGGAGGACTGGGACTTGGTT
ACGAGGCAGAAGCAGTTGTTCCAGCTCCCTGCTAAAAAGAATGTCGATGCCATTCTTGAGGAGTATGCCA
ATTGTAAGAAGTCGCAGGGAAATGTTGATAATAAGGAGTACGCAGTTAATGAAGTTGTAGGAGGGATAAA
AGAGTATTTCAATGTGATGCTGGGCACTCAGCTGCTGTACAAGTTTGAAAGGCCTCAGTATGCTGAGATT
CTGCTGGCTCACCCTGATGCGCCGATGTCGCAGATCTATGGGGCGCCACACCTCCTGAGATTATTCGTGA
GAATTGGGGCAATGTTGGCCTATACGCCCCTTGATGAGAAAAGCCTGGCATTATTGCTGGGCTATCTGCA
TGATTTCCTTAAGTATCTGGCAAAGAATTCTGCCTCTCTGTTTACTGCCAGTGATTACAAAGTGGCTTCT
GCTGACTATCATCGCAAAGCCCTGTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI |
ACCN NM_001168225
Insert Size 867 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001168225.1, NP_001161697.1
RefSeq Size 1947 bp
RefSeq ORF 867 bp
Locus ID 56397
UniProt ID Q9R0Q4
Cytogenetics X F1
Summary Component of the NuA4 histone acetyltransferase complex which is involved in transcriptional activation of select genes principally by acetylation of nucleosomal histone H4 and H2A. This modification may both alter nucleosome - DNA interactions and promote interaction of the modified histones with other proteins which positively regulate transcription. This complex may be required for the activation of transcriptional programs associated with oncogene and proto-oncogene mediated growth induction, tumor suppressor mediated growth arrest and replicative senescence, apoptosis, and DNA repair. The NuA4 complex ATPase and helicase activities seem to be, at least in part, contributed by the association of RUVBL1 and RUVBL2 with EP400. NuA4 may also play a direct role in DNA repair when directly recruited to sites of DNA damage. Also component of the MSIN3A complex which acts to repress transcription by deacetylation of nucleosomal histones (By similarity).UniProtKB/Swiss-Prot Function
Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. Variants 1 through 7 encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
Reviews
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_001168225" in other vectors (4)
SKU Description Size Price
MG219311 Morf4l2 (tGFP-tagged) - Mouse mortality factor 4 like 2 (Morf4l2) transcript variant 2, (10ug) 10 ug
$500.00
MR219311 Morf4l2 (Myc-DDK-tagged) - Mouse mortality factor 4 like 2 (Morf4l2), transcript variant 2 10 ug
$289.00 $300.00
MR219311L3 Lenti ORF clone of Morf4l2 (Myc-DDK-tagged) - Mouse mortality factor 4 like 2 (Morf4l2), transcript variant 2 10 ug
$600.00
MR219311L4 Lenti ORF clone of Morf4l2 (mGFP-tagged) - Mouse mortality factor 4 like 2 (Morf4l2), transcript variant 2 10 ug
$600.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products