OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

Batf (NM_016767) Mouse Untagged Clone

Be the first to review this product
SKU
MC209926
Batf (untagged) - Mouse basic leucine zipper transcription factor, ATF-like (Batf), (10ug)
Interest in protein/lysate? Submit request here!
ORF Plasmid:
Tag Free tGFP DDK
AAV Particle:
DDK
  $150.00
In Stock*
Bulk Requests & Clone Modifications

Frequently Bought Together (3)

CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "Batf or NM_016767"

Specifications
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Batf
Synonyms B-ATF; SFA-2
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>MC209926 representing NM_016767
Red=Cloning site Blue=ORF

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGCCTCACAGCTCCGACAGCAGTGACTCCAGCTTCAGCCGCTCTCCTCCCCCTGGCAAACAGGACTCAT
CTGATGATGTGAGGAAAGTTCAGAGGAGAGAGAAGAATCGCATCGCTGCCCAGAAGAGCCGACAGAGACA
GACACAGAAAGCCGACACCCTTCACCTGGAGAGTGAGGACCTGGAGAAACAGAACGCAGCTCTCCGCAAA
GAGATCAAACAGCTCACCGAGGAGCTCAAGTACTTCACATCAGTGCTGAGCAGCCACGAGCCCCTGTGCT
CCGTGCTGGCCAGTGGCACCCCCTCGCCCCCCGAGGTGGTATACAGTGCCCATGCCTTCCACCAGCCTCA
CATCAGCTCGCCACGCTTCCAGCCCTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI |
ACCN NM_016767
Insert Size 378 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq BC132410, AAI32411
RefSeq Size 710 bp
RefSeq ORF 378 bp
Locus ID 53314
UniProt ID O35284
Cytogenetics 12 D2
Summary AP-1 family transcription factor that controls the differentiation of lineage-specific cells in the immune system: specifically mediates the differentiation of T-helper 17 cells (Th17), follicular T-helper cells (TfH), CD8(+) dendritic cells and class-switch recombination (CSR) in B-cells. Acts via the formation of a heterodimer with JUNB that recognizes and binds DNA sequence 5'-TGACGTCA-3'. The BATF-JUNB heterodimer also forms a complex with IRF4 (or IRF8) in immune cells, leading to recognition of AICE sequence (5'-TGAnTCA/GAAA-3'), an immune-specific regulatory element, followed by cooperative binding of BATF and IRF4 (or IRF8) and activation of genes. Controls differentiation of T-helper cells producing interleukin-17 (Th17 cells) by binding to Th17-associated gene promoters: regulates expression of the transcription factor RORC itself and RORC target genes such as IL17 (IL17A or IL17B). Also involved in differentiation of follicular T-helper cells (TfH) by directing expression of BCL6 and MAF. In B-cells, involved in class-switch recombination (CSR) by controlling the expression of both AICDA and of germline transcripts of the intervening heavy-chain region and constant heavy-chain region (I(H)-C(H)). Following infection, can participate in CD8(+) dendritic cell differentiation via interaction with IRF4 and IRF8 to mediate cooperative gene activation. Regulates effector CD8(+) T-cell differentiation by regulating expression of SIRT1. Following DNA damage, part of a differentiation checkpoint that limits self-renewal of hematopoietic stem cells (HSCs): up-regulated by STAT3, leading to differentiation of HSCs, thereby restricting self-renewal of HSCs.UniProtKB/Swiss-Prot Function
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_016767" in other vectors (4)
SKU Description Size Price
MG222114 Batf (tGFP-tagged) - Mouse basic leucine zipper transcription factor ATF-like (Batf), (10ug) 10 ug
$489.00
MR222114 Batf (Myc-DDK-tagged) - Mouse basic leucine zipper transcription factor, ATF-like (Batf) 10 ug
$289.00
MR222114L3 Lenti ORF clone of Batf (Myc-DDK-tagged) - Mouse basic leucine zipper transcription factor, ATF-like (Batf) 10 ug
$450.00
MR222114L4 Lenti ORF clone of Batf (mGFP-tagged) - Mouse basic leucine zipper transcription factor, ATF-like (Batf) 10 ug
$450.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products