Ccnc (NM_016746) Mouse Untagged Clone

SKU
MC209886
Ccnc (untagged) - Mouse cyclin C (Ccnc), transcript variant 1, (10ug)
  $300.00
In Stock*
Specifications
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Ccnc
Synonyms AI451004; AU020987; CG1C
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>MC209886 representing NM_016746
Red=Cloning site Blue=ORF

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCAGGGAACTTCTGGCAGAGCTCCCACTATTTGCAGTGGATTTTGGATAAACAAGATCTGTTGAAAG
AGCGCCAAAAGGACCTAAAGTTTCTCTCAGAAGAGGAGTATTGGAAGTTACAAATATTTTTTACAAATGT
TATCCAAGCATTAGGTGAACATCTTAAATTAAGACAACAAGTTATTGCTACTGCTACAGTCTATTTCAAG
AGATTCTATGCTAGGTATTCTCTGAAAAGTATAGATCCTGTATTAATGGCGCCTACATGTGTGTTTCTGG
CATCCAAAGTAGAGGAATTTGGTGTTGTCTCAAATACAAGATTGATTGCTGCTACTACTTCTGTATTAAA
AACTAGATTTTCATATGCTTTTCCAAAGGAATTTCCTTACAGGATGAATCATATACTAGAATGTGAATTT
TACCTCTTAGAATTAATGGACTGTTGCTTGATAGTGTATCATCCTTATAGACCTTTGCTCCAGTATGTGC
AGGACATGGGCCAGGAAGACGTGCTGCTTCCCCTTGCATGGAGGATAGTGAATGATACCTACAGGACGGA
TCTCTGTCTGCTGTACCCTCCGTTCATGATCGCTTTAGCTTGCCTACATGTAGCCTGTGTCGTACAACAG
AAAGATGCTAGACAGTGGTTTGCAGAACTTTCTGTGGATATGGAGAAGATTTTGGAAATAATCAGGGTTA
TTTTAAAACTGTATGAGCAGTGGAAGAATTTTGATGAGAGAAAAGAGATGGCAACTATTCTTAGTAAGAT
GCCGAAACCAAAACCACCTCCAAACAGTGAAGGTGAGCAGGGTCCAAATGGAAGTCAGAACTCTAGCTAC
AGCCAATCTTAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI |
ACCN NM_016746
Insert Size 852 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq BC120649, AAI20650
RefSeq Size 2377 bp
RefSeq ORF 852 bp
Locus ID 51813
UniProt ID Q62447
Cytogenetics 4 A3
Summary Component of the Mediator complex, a coactivator involved in regulated gene transcription of nearly all RNA polymerase II-dependent genes. Mediator functions as a bridge to convey information from gene-specific regulatory proteins to the basal RNA polymerase II transcription machinery. Mediator is recruited to promoters by direct interactions with regulatory proteins and serves as a scaffold for the assembly of a functional preinitiation complex with RNA polymerase II and the general transcription factors. Binds to and activates cyclin-dependent kinase CDK8 that phosphorylates the CTD (C-terminal domain) of the large subunit of RNA polymerase II (RNAp II), which may inhibit the formation of a transcription initiation complex (By similarity).UniProtKB/Swiss-Prot Function
Transcript Variant: This variant (1) encodes the longest isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
Reviews
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_016746" in other vectors (4)
SKU Description Size Price
MG216530 Ccnc (tGFP-tagged) - Mouse cyclin C (Ccnc) transcript variant 1, (10ug) 10 ug
$500.00
MR216530 Ccnc (Myc-DDK-tagged) - Mouse cyclin C (Ccnc), transcript variant 1 10 ug
$289.00 $300.00
MR216530L3 Lenti ORF clone of Ccnc (Myc-DDK-tagged) - Mouse cyclin C (Ccnc), transcript variant 1 10 ug
$600.00
MR216530L4 Lenti ORF clone of Ccnc (mGFP-tagged) - Mouse cyclin C (Ccnc), transcript variant 1 10 ug
$600.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products