OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

Cd27 (NM_001033126) Mouse Untagged Clone

Be the first to review this product
SKU
MC209547
Cd27 (untagged) - Mouse CD27 antigen (Cd27), transcript variant 1, (10ug)
Interest in protein/lysate? Submit request here!
ORF Plasmid:
Tag Free tGFP DDK
  $450.00
In Stock*
Bulk Requests & Clone Modifications

Frequently Bought Together (3)

TA386053 Recombinant Anti-CD27 (Clone LG.3A10)
200 ug
$770.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "Cd27 or NM_001033126"

Specifications
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Cd27
Synonyms S152; Tnfrsf7; Tp55
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>MC209547 representing NM_001033126
Red=Cloning site Blue=ORF

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCATGGCCACCTCCCTACTGGCTCTGCATGCTGGGGACCTTGGTAGGACTCTCAGCTACCCTAGCCC
CAAACAGCTGTCCAGACAAACACTACTGGACTGGGGGAGGACTCTGCTGCCGGATGTGTGAGCCAGGTAC
ATTCTTTGTGAAGGACTGTGAACAAGACAGAACAGCTGCTCAGTGTGATCCCTGTATACCAGGCACCTCC
TTCTCTCCAGACTACCACACCCGGCCCCACTGCGAGAGCTGCAGGCATTGTAACTCTGGTTTTCTTATCC
GCAACTGCACAGTCACTGCCAATGCTGAGTGCAGCTGTTCCAAGAACTGGCAGTGCAGGGACCAGGAATG
TACAGAGTGTGACCCTCCTCTAAACCCTGCACTGACCAGACAGCCATCTGAGACCCCGAGCCCACAGCCA
CCACCCACCCACTTACCTCATGGCACAGAGAAGCCATCCTGGCCCCTACACAGGCAGCTTCCCAACTCGA
CTGTCTATAGCCAGCGGTCATCCCATAGACCCCTGTGCAGCTCGGACTGCATCCGGATCTTTGTGACCTT
CTCCAGCATGTTTCTTATCTTCGTCCTGGGTGCAATCTTGTTCTTCCATCAAAGAAGAAACCACGGGCCA
AATGAAGACCGGCAGGCAGTGCCTGAAGAGCCTTGTCCTTACAGCTGCCCCAGGGAAGAGGAGGGCAGTG
CTATCCCTATCCAGGAGGACTACCGGAAACCCGAGCCTGCTTTCTACCCTTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI |
ACCN NM_001033126
Insert Size 753 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq BC139125, AAI39126
RefSeq Size 992 bp
RefSeq ORF 753 bp
Locus ID 21940
UniProt ID P41272
Cytogenetics 6 59.32 cM
Summary Receptor for CD70/CD27L. May play a role in survival of activated T-cells. May play a role in apoptosis through association with SIVA1.UniProtKB/Swiss-Prot Function
Transcript Variant: This variant (1) represents the longest transcript and encodes the longest isoform (a). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_001033126" in other vectors (4)
SKU Description Size Price
MG226565 Cd27 (tGFP-tagged) - Mouse CD27 antigen (Cd27) transcript variant 1, (10ug) 10 ug
$650.00
MR226565 Cd27 (Myc-DDK-tagged) - Mouse CD27 antigen (Cd27), transcript variant 1 10 ug
$450.00
MR226565L3 Lenti ORF clone of Cd27 (Myc-DDK-tagged) - Mouse CD27 antigen (Cd27), transcript variant 1 10 ug
$750.00
MR226565L4 Lenti ORF clone of Cd27 (mGFP-tagged) - Mouse CD27 antigen (Cd27), transcript variant 1 10 ug
$750.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products