OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

Strap (NM_011499) Mouse Untagged Clone

Be the first to review this product
SKU
MC209478
Strap (untagged) - Mouse serine/threonine kinase receptor associated protein (Strap), (10ug)
Interest in protein/lysate? Submit request here!
ORF Plasmid:
Tag Free tGFP DDK
AAV Particle:
DDK
  $503.00
3 Weeks*
Bulk Requests & Clone Modifications

Frequently Bought Together (4)

TA362893 STRAP Antibody - middle region
100 ul
$585.00
CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "Strap or NM_011499"

Specifications
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Strap
Synonyms AW557906; C78091; C79202; Unrip
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>MC209478 representing NM_011499
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCCATGAGGCAGACGCCGCTCACTTGCTCGGGCCACACGCGGCCCGTGGTGGATTTGGCCTTCAGCG
GCATCACGCCTTACGGCTACTTTCTGATCAGCGCTTGCAAAGATGGCAAGCCCATGCTCCGCCAGGGAGA
TACAGGAGACTGGATTGGAACATTTTTGGGTCATAAAGGTGCTGTTTGGGGTGCAACATTGAATAAGGAT
GCCACCAAAGCTGCGACAGCAGCTGCAGACTTCACAGCCAAAGTATGGGATGCGGTCTCAGGAGATGAAT
TGATGACCCTGGCTCATAAGCACATTGTCAAGACTGTGGATTTCACACAGGATAGCAATTACCTGCTAAC
TGGGGGACAGGATAAACTGCTGCGCATATATGACTTGAACAAACCTGAAGCAGAACCTAAGGAAATCAGT
GGCCACACTTCTGGTATTAAAAAGGCTCTGTGGTGCAGTGACGATAAACAGATCCTTTCAGCGGATGATA
AAACTGTTCGGCTCTGGGATCATGCCACAATGACAGAAGTGAAATCTCTGAATTTTAATATGTCTGTTAG
CAGCATGGAGTATATTCCTGAAGGAGAGATTTTGGTTATTACTTATGGACGATCTATTGCTTTTCATAGT
GCAGTAAGTCTGGAGCCAATTAAATCCTTTGAAGCTCCTGCGACCATCAATTCTGCGTCTCTTCATCCAG
AGAAGGAGTTTCTTGTTGCGGGTGGAGAAGACTTTAAACTGTACAAGTATGATTATAACAGTGGAGAAGA
GTTAGAATCCTACAAAGGTCACTTTGGTCCCATTCACTGTGTGAGATTCAGTCCTGATGGGGAACTCTAT
GCCAGCGGTTCTGAAGATGGGACATTGAGATTGTGGCAAACTGTGGTAGGAAAGACCTATGGCCTGTGGA
AATGCGTGCTTCCTGAGGAAGACAGCGGGGAACTGGCAAAGCCAAAGATCGGATTTCCAGAAACAGCAGA
GGAAGAGCTGGAAGAAATTGCTTCAGAGAATTCAGATTCCATCTATTCATCAACTCCTGAAGTTAAGGCC
TGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI |
ACCN NM_011499
Insert Size 1053 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_011499.3, NP_035629.2
RefSeq Size 2644 bp
RefSeq ORF 1053 bp
Locus ID 20901
UniProt ID Q9Z1Z2
Cytogenetics 6 G1
Summary The SMN complex plays a catalyst role in the assembly of small nuclear ribonucleoproteins (snRNPs), the building blocks of the spliceosome. Thereby, plays an important role in the splicing of cellular pre-mRNAs. Most spliceosomal snRNPs contain a common set of Sm proteins SNRPB, SNRPD1, SNRPD2, SNRPD3, SNRPE, SNRPF and SNRPG that assemble in a heptameric protein ring on the Sm site of the small nuclear RNA to form the core snRNP. In the cytosol, the Sm proteins SNRPD1, SNRPD2, SNRPE, SNRPF and SNRPG are trapped in an inactive 6S pICln-Sm complex by the chaperone CLNS1A that controls the assembly of the core snRNP. Dissociation by the SMN complex of CLNS1A from the trapped Sm proteins and their transfer to an SMN-Sm complex triggers the assembly of core snRNPs and their transport to the nucleus. STRAP plays a role in the cellular distribution of the SMN complex. Negatively regulates TGF-beta signaling but positively regulates the PDPK1 kinase activity by enhancing its autophosphorylation and by significantly reducing the association of PDPK1 with 14-3-3 protein (By similarity).UniProtKB/Swiss-Prot Function
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_011499" in other vectors (4)
SKU Description Size Price
MG217694 Strap (tGFP-tagged) - Mouse serine/threonine kinase receptor associated protein (Strap), (10ug) 10 ug
$657.00
MR217694 Strap (Myc-DDK-tagged) - Mouse serine/threonine kinase receptor associated protein (Strap) 10 ug
$289.00 $457.00
MR217694L3 Lenti ORF clone of Strap (Myc-DDK-tagged) - Mouse serine/threonine kinase receptor associated protein (Strap) 10 ug
$757.00
MR217694L4 Lenti ORF clone of Strap (mGFP-tagged) - Mouse serine/threonine kinase receptor associated protein (Strap) 10 ug
$757.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products