OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

Sh2d1a (NM_011364) Mouse Untagged Clone

Be the first to review this product
SKU
MC209391
Sh2d1a (untagged) - Mouse SH2 domain protein 1A (Sh2d1a), (10ug)
Interest in protein/lysate? Submit request here!
ORF Plasmid:
Tag Free tGFP DDK
  $165.00
2 Weeks*
Bulk Requests & Clone Modifications

Frequently Bought Together (3)

CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "Sh2d1a or NM_011364"

Specifications
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Sh2d1a
Synonyms Gm686; SAP
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>MC209391 representing NM_011364
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGATGCAGTGACTGTGTACCACGGCAAAATCAGCAGGGAGACCGGGGAGAAGCTCTTACTCGCTACCG
GGCTGGATGGAAGCTATCTGCTGCGAGACAGCGAGAGTGTCCCTGGCGTGTACTGCCTGTGTGTTTTGTA
TCAAGGTTACATCTACACATATCGAGTGTCCCAGACAGAAACAGGTTCTTGGAGTGCCGAGACAGCACCT
GGAGTACATAAAAGATTTTTCCGGAAAGTAAAAAATCTCATCTCAGCGTTTCAGAAGCCGGATCAAGGCA
TCGTGACGCCTCTGCAGTATCCAGTTGAAAAGTCCTCTGGCAGGGGCCCACAAGCTCCCACAGGGAGAAG
AGATTCTGATATCTGCCTGAATGCACCATGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI |
ACCN NM_011364
Insert Size 381 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_011364.4, NP_035494.1
RefSeq Size 888 bp
RefSeq ORF 381 bp
Locus ID 20400
UniProt ID O88890
Cytogenetics X A4
Summary Cytoplasmic adapter regulating receptors of the signaling lymphocytic activation molecule (SLAM) family such as SLAMF1, CD244, LY9, CD84, SLAMF6 and SLAMF7. In SLAM signaling seems to cooperate with SH2D1B/EAT-2. Initially it has been proposed that association with SLAMF1 prevents SLAMF1 binding to inhibitory effectors including INPP5D/SHIP1 and PTPN11/SHP-2. However, by simultaneous interactions, recruits FYN which subsequently phosphorylates and activates SLAMF1 (By similarity). Positively regulates CD244/2B4- and CD84-mediated natural killer (NK) cell functions (PubMed:22683124). Can also promote CD48-, SLAMF6 -, LY9-, and SLAMF7-mediated NK cell activation (PubMed:19648922). In the context of NK cell-mediated cytotoxicity enhances conjugate formation with target cells (PubMed:22683124). May also regulate the activity of the neurotrophin receptors NTRK1, NTRK2 and NTRK3.UniProtKB/Swiss-Prot Function
Transcript Variant: This variant (2) lacks an alternate in-frame exon compared to variant 1. The resulting isoform (2) has the same N- and C-termini but is shorter compared to isoform 1.
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_011364" in other vectors (6)
SKU Description Size Price
MG226695 Sh2d1a (tGFP-tagged) - Mouse SH2 domain protein 1A (Sh2d1a), (10ug) 10 ug
$425.00
MR226695 Sh2d1a (Myc-DDK-tagged) - Mouse SH2 domain protein 1A (Sh2d1a) 10 ug
$225.00
MR226695L1 Lenti ORF clone of Sh2d1a (Myc-DDK-tagged) - Mouse SH2 domain protein 1A (Sh2d1a) 10 ug
$525.00
MR226695L2 Lenti ORF clone of Sh2d1a (mGFP-tagged) - Mouse SH2 domain protein 1A (Sh2d1a) 10 ug
$525.00
MR226695L3 Lenti ORF clone of Sh2d1a (Myc-DDK-tagged) - Mouse SH2 domain protein 1A (Sh2d1a) 10 ug
$525.00
MR226695L4 Lenti ORF clone of Sh2d1a (mGFP-tagged) - Mouse SH2 domain protein 1A (Sh2d1a) 10 ug
$525.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products