Gal (NM_010253) Mouse Untagged Clone

SKU
MC208519
Gal (untagged) - Mouse galanin (Gal), (10ug)
  $165.00
2 Weeks*
Specifications
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Gal
Synonyms G; Galn
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>MC208519 representing NM_010253
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCCAGAGGCAGCGTTATCCTGCTAGGCTGGCTCCTGTTGGTTGTGACCCTGTCAGCCACTCTGGGAC
TTGGGATGCCTGCAAAGGAGAAGAGAGGTTGGACCCTGAACAGCGCTGGCTACCTTCTGGGCCCACATGC
CATTGACAACCACAGATCATTTAGCGACAAGCATGGCCTCACAGGCAAGAGGGAGTTACAACTGGAGGTG
GAGGAAAGGAGACCAGGAAGTGTTGATGTGCCCCTGCCTGAGAGCAACATTGTCCGCACTATAATGGAGT
TTCTCAGTTTCTTGCACCTTAAAGAGGCCGGGGCCCTCGACAGCCTGCCTGGCATCCCCTTGGCCACCTC
CTCAGAAGACCTAGAGAAGTCCTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI |
ACCN NM_010253
Insert Size 375 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_010253.3, NP_034383.1
RefSeq Size 699 bp
RefSeq ORF 375 bp
Locus ID 14419
UniProt ID P47212
Cytogenetics 19 3.16 cM
Summary This gene encodes a neuroendocrine peptide that is principally produced by a subpopulation of lactotrophs in the pituitary gland. The encoded protein is a precursor that is proteolytically processed to generate two mature peptides: galanin and galanin message-associated peptide (GMAP). Mice lacking the encoded protein fail to lactate sufficiently due to abnormalities in the expression of prolactin and lactotroph proliferation, exhibit attenuated chronic neuropathic pain and developmental deficits in the dorsal root ganglion neurons. This gene encodes distinct isoforms, some or all of which may undergo similar processing to generate the mature proteins. provided by RefSeq, Jul 2016
Transcript Variant: This variant (1) represents the longer transcript and encodes the shorter protein (isoform 1).
Reviews
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_010253" in other vectors (4)
SKU Description Size Price
MG225635 Gal (tGFP-tagged) - Mouse galanin (Gal), (10ug) 10 ug
$350.00
MR225635 Gal (Myc-DDK-tagged) - Mouse galanin (Gal) 10 ug
$289.00
MR225635L3 Lenti ORF clone of Gal (Myc-DDK-tagged) - Mouse galanin (Gal) 10 ug
$450.00
MR225635L4 Lenti ORF clone of Gal (mGFP-tagged) - Mouse galanin (Gal) 10 ug
$450.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products