Bex2 (NM_009749) Mouse Untagged Clone

SKU
MC208186
Bex2 (untagged) - Mouse brain expressed X-linked 2 (Bex2), (10ug)
  $240.00
2 Weeks*
Specifications
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Bex2
Synonyms AL024066; Bex1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>MC208186 representing NM_009749
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGAGTCCAAAGTGGAACAAGGCGTGAAAAATCTCAACATGGAGAATGACCATCAGGAAAAGGAGGAAA
AGGAAGAAAAGCCACAGGATGCTAGCAAAAGGGATCCGATTGTGGCCCTGCCTTTCGAAGCTGGAGACTA
CTACGTGCCTAGAGGAGGTCGCAGGCGGTTCCGGGTTCGGCAGCCCATCGTGCACTACAGATGGGACCTG
ATGCATAGGGTTGGGGAGCCCCAGGGAAGGATGAGAGAGGAGAACGTACAGAGGTTTGGGGATGATGTGA
GACAGCTCATGGAGAAGCTGAGGGAAAGGCAGCTGAGCCACAGCCTGCGGGCGGTTAGCACTGACCCGCC
TCATCATGACCACCATGATGAGTTTTGCCTTATGCCCTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI |
ACCN NM_009749
Insert Size 390 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_009749.2, NP_033879.1
RefSeq Size 902 bp
RefSeq ORF 390 bp
Locus ID 12069
UniProt ID Q9WTZ8
Cytogenetics X 57.37 cM
Summary Regulator of mitochondrial apoptosis and G1 cell cycle. Regulates the level of PP2A regulatory subunit B and PP2A phosphatase activity (By similarity).UniProtKB/Swiss-Prot Function
Reviews
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_009749" in other vectors (4)
SKU Description Size Price
MG222112 Bex2 (tGFP-tagged) - Mouse brain expressed X-linked 2 (Bex2), (10ug) 10 ug
$440.00
MR222112 Bex2 (Myc-DDK-tagged) - Mouse brain expressed X-linked 2 (Bex2) 10 ug
$240.00
MR222112L3 Lenti ORF clone of Bex2 (Myc-DDK-tagged) - Mouse brain expressed X-linked 2 (Bex2) 10 ug
$540.00
MR222112L4 Lenti ORF clone of Bex2 (mGFP-tagged) - Mouse brain expressed X-linked 2 (Bex2) 10 ug
$540.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products