OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

Avpr2 (NM_019404) Mouse Untagged Clone

Be the first to review this product
SKU
MC208169
Avpr2 (untagged) - Mouse arginine vasopressin receptor 2 (Avpr2), (10ug)
Interest in protein/lysate? Submit request here!
ORF Plasmid:
Tag Free tGFP DDK
AAV Particle:
DDK
  $457.00
In Stock*
Bulk Requests & Clone Modifications

Frequently Bought Together (3)

CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "Avpr2 or NM_019404"

Specifications
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Avpr2
Synonyms ADHR; DI; DI1; DIR; ND; ND1; V; V2R; VPV2R
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>MC208169 representing NM_019404
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGATCCTGGTGTCTACCACGTCTGCAGTGCCTGGGGCCCTTTCGTCCCCTAGCTCTCCCAGCAACAGCA
GCCAGGAGGAGCTACTGGATGACCGAGACCCGCTGTTAGTCCGGGCTGAACTGGCCCTGCTATCTACAAT
TTTTGTGGCTGTGGCCTTGAGCAATGGCCTAGTGCTTGGGGCCCTAATACGACGGGGTCGGCGTGGACGC
TGGGCACCCATGCACGTCTTCATCAGTCATTTGTGCCTAGCTGACCTGGCTGTGGCTCTGTTTCAAGTGC
TGCCCCAGCTGGCTTGGGATGCCACCGACCGCTTCCATGGCCCTGATGCCTTGTGTCGGGCCGTCAAGTA
CCTGCAGATGGTGGGCATGTATGCCTCTTCCTACATGATCCTGGCCATGACACTAGACCGCCATCGCGCC
ATCTGCCGCCCTATGCTGGCATACCGCCATGGAGGTGGGGCTCGCTGGAACAGGCCAGTGCTGGTGGCCT
GGGCCTTCTCACTCCTTCTCAGCCTGCCTCAGCTCTTCATCTTTGCTCAACGTGATGTGGGAAATGGCAG
TGGGGTATTTGATTGCTGGGCCCGATTTGCAGAGCCATGGGGCCTTCGTGCCTATGTCACCTGGATCGCC
TTGATGGTGTTTGTGGCACCTGCCCTAGGCATTGCTGCCTGCCAGGTTCTTATCTTCCGGGAGATACATG
CCAGTCTGGTGCCAGGGCCATCTGAAAGGGCAGGGAGGCGCCGCAGAGGACACCGGACAGGAAGTCCCAG
CGAGGGAGCCCATGTATCAGCAGCCATGGCCAAGACCGTGAGGATGACACTGGTGATTGTGATTGTCTAC
GTGCTGTGCTGGGCACCCTTCTTCCTTGTGCAGCTGTGGGCAGCGTGGGATCCAGAAGCTCCTCTGGAAA
GACCCCCCTTTGTGTTGCTCATGCTGCTGGCTAGCCTTAACAGCTGTACCAACCCCTGGATCTATGCTTC
CTTCAGTAGCAGTGTCTCCTCGGAGTTGCGTAGCCTGCTTTGCTGTGCTCAGAGGCACACCACACACAGC
CTGGGTCCTCAAGATGAGTCCTGTGCCACAGCCAGCTCCTCTCTGATGAAGGATACACCCTCCTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Chromatograms Chromatograms
Sequencher program is needed, download here
Restriction Sites SgfI-MluI |
ACCN NM_019404
Insert Size 1116 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_019404.2, NP_062277.1
RefSeq Size 1812 bp
RefSeq ORF 1116 bp
Locus ID 12000
UniProt ID O88721
Cytogenetics X 37.46 cM
Summary This gene encodes a member of the G-protein coupled receptor 1 family and the vasopressin/oxytocin receptor subfamily. The encoded protein is an arginine vasopressin receptor which, when stimulated, activates the Gs protein/adenylyl cyclase signaling cascade and is involved in water and electrolyte homeostasis. Alternative splicing results in multiple transcript variants. provided by RefSeq, Jan 2013
Transcript Variant: This variant (1) represents the longest transcript and encodes the longest isoform (a). Sequence Note: This RefSeq record was created from transcript and genomic sequence data because no single transcript from the same strain was available for the full length of the gene. The extent of this transcript is supported by transcript alignments and orthologous data.
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_019404" in other vectors (4)
SKU Description Size Price
MG220919 Avpr2 (tGFP-tagged) - Mouse arginine vasopressin receptor 2 (Avpr2), (10ug) 10 ug
$657.00
MR220919 Avpr2 (Myc-DDK-tagged) - Mouse arginine vasopressin receptor 2 (Avpr2) 10 ug
$289.00 $457.00
MR220919L3 Lenti ORF clone of Avpr2 (Myc-DDK-tagged) - Mouse arginine vasopressin receptor 2 (Avpr2) 10 ug
$757.00
MR220919L4 Lenti ORF clone of Avpr2 (mGFP-tagged) - Mouse arginine vasopressin receptor 2 (Avpr2) 10 ug
$757.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products