OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

Speg (NM_001173477) Mouse Untagged Clone

Be the first to review this product
SKU
MC208133
Speg (untagged) - Mouse SPEG complex locus (Speg), transcript variant 4, (10ug)
Interest in protein/lysate? Submit request here!
ORF Plasmid:
Tag Free tGFP DDK
  $240.00
2 Weeks*
Bulk Requests & Clone Modifications

Frequently Bought Together (2)

PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "Speg or NM_001173477"

Specifications
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Speg
Synonyms Apeg1; AW125581; BPEG; D1Bwg1450e; mKIAA1297; SPEGalpha; SPEGbeta
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>MC208133 representing NM_001173477
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGAAGCTCAGTCCCAGCCAGGATCATGATTCCTCCGACTCTTCTTCCAAGGCACCCCCAACGTTCAAGG
TCTCACTCATGGACCAATCGGTGAGAGAAGGTCAAGATGTCATTATGAGCATCCGTGTGCAGGGAGAGCC
CAAGCCTGTGGTTTCCTGGCTGAGGAATCGACAGCCCGTGCGCCCAGACCAGCGGCGCTTTGCAGAGGAG
GCCGAGGGTGGGCTCTGCCGCTTGAGGATCCTGGCTGCTGAACGGGGCGATGCTGGTTTCTACACATGCA
AGGCGGTCAACGAATATGGCGCTCGGCAGTGCGAGGCCCGCCTGGAGGTCCGAGGCGAGTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI |
ACCN NM_001173477
Insert Size 342 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001173477.1, NP_001166948.1
RefSeq Size 1423 bp
RefSeq ORF 342 bp
Locus ID 11790
UniProt ID Q62407
Cytogenetics 1 38.88 cM
Summary This gene encodes a protein with similarity to members of the myosin light chain kinase family. This protein family is required for myocyte cytoskeletal development. Studies have determined that a lack of this protein affected myocardial development. Multiple alternatively spliced transcript variants that encode different protein isoforms have been defined. provided by RefSeq, Mar 2010
Transcript Variant: This variant (4) has multiple differences, compared to variant 1. These differences result in a distinct 5' UTR and cause translation initiation at a downstream start codon, compared to variant 1. The encoded protein (isoform 4) is shorter than isoform 1. This variant corresponds to variant APEG-1 described in PubMed ID: 10973969.
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_001173477" in other vectors (4)
SKU Description Size Price
MG219244 Speg (tGFP-tagged) - Mouse SPEG complex locus (Speg) transcript variant 4, (10ug) 10 ug
$425.00
MR219244 Speg (Myc-DDK-tagged) - Mouse SPEG complex locus (Speg), transcript variant 4 10 ug
$225.00
MR219244L3 Lenti ORF clone of Speg (Myc-DDK-tagged) - Mouse SPEG complex locus (Speg), transcript variant 4 10 ug
$525.00
MR219244L4 Lenti ORF clone of Speg (mGFP-tagged) - Mouse SPEG complex locus (Speg), transcript variant 4 10 ug
$525.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products