Irf3 (NM_016849) Mouse Untagged Clone

SKU
MC207502
Irf3 (untagged) - Mouse interferon regulatory factor 3 (Irf3), (10ug)
  $686.00
In Stock*
Specifications
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Irf3
Synonyms C920001K05Rik; IRF-3
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>MC207502 representing NM_016849
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGAAACCCCGAAACCGCGGATTTTGCCCTGGCTGGTGTCACAGCTGGACCTGGGGCAGCTGGAAGGCG
TGGCCTGGCTGGACGAGAGCCGAACGAGGTTCAGGATCCCGTGGAAGCATGGCCTACGGCAGGACGCACA
GATGGCTGACTTTGGCATCTTCCAGGCCTGGGCAGAAGCCAGTGGTGCCTACACCCCGGGGAAGGATAAG
CCGGACGTGTCAACCTGGAAGAGGAATTTCCGGTCAGCCCTGAACCGGAAAGAAGTGTTGCGGTTAGCTG
CTGACAATAGCAAGGACCCTTATGACCCTCATAAAGTGTATGAGTTTGTGACTCCAGGGGCGCGGGACTT
CGTACATCTGGGTGCCTCTCCTGACACCAATGGCAAAAGCAGCCTGCCTCACTCCCAGGAAAACCTACCG
AAGTTATTTGATGGCCTGATCTTGGGGCCCCTCAAAGATGAGGGGTCCTCAGATCTGGCTATTGTTTCTG
ATCCTTCTCAACAACTGCCAAGCCCCAATGTGAACAACTTCCTAAACCCTGCACCCCAAGAAAATCCACT
GAAGCAGCTGCTAGCTGAGGAACAATGGGAGTTCGAGGTGACCGCCTTCTACCGAGGCCGCCAGGTCTTC
CAGCAGACACTCTTTTGCCCGGGGGGCCTGCGGCTGGTGGGCAGCACAGCTGACATGACACTGCCCTGGC
AGCCAGTCACCCTGCCCGATCCTGAGGGGTTTCTGACGGACAAGCTTGTGAAGGAGTACGTGGGGCAGGT
GCTCAAAGGGCTGGGCAATGGGCTGGCACTGTGGCAGGCTGGGCAGTGCCTCTGGGCCCAGCGCCTAGGC
CACTCCCACGCCTTCTGGGCTCTGGGGGAGGAGCTGCTTCCAGACAGTGGGCGAGGGCCTGATGGAGAGG
TCCACAAGGACAAGGACGGAGCCGTGTTCGACCTCAGGCCCTTCGTGGCAGATCTGATTGCCTTCATGGA
AGGAAGTGGACACTCCCCACGCTACACTCTGTGGTTCTGCATGGGGGAAATGTGGCCCCAGGACCAGCCA
TGGGTCAAGAGGCTTGTGATGGTCAAGGTTGTTCCTACATGTCTTAAGGAGCTGTTAGAGATGGCCCGGG
AAGGGGGAGCCTCTTCACTGAAAACCGTGGACTTGCACATCTCCAACAGCCAGCCTATCTCCCTTACCTC
TGACCAGTACAAGGCCTACCTCCAGGACTTGGTGGAGGACATGGACTTCCAGGCCACTGGAAATATCTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Chromatograms Chromatograms
Sequencher program is needed, download here
Restriction Sites SgfI-MluI |
ACCN NM_016849
Insert Size 1260 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq BC050882, AAH50882
RefSeq Size 2053 bp
RefSeq ORF 1260 bp
Locus ID 54131
UniProt ID P70671
Cytogenetics 7 B3
Summary Key transcriptional regulator of type I interferon (IFN)-dependent immune responses which plays a critical role in the innate immune response against DNA and RNA viruses (PubMed:15800576). Regulates the transcription of type I IFN genes (IFN-alpha and IFN-beta) and IFN-stimulated genes (ISG) by binding to an interferon-stimulated response element (ISRE) in their promoters (PubMed:15800576). Acts as a more potent activator of the IFN-beta (IFNB) gene than the IFN-alpha (IFNA) gene and plays a critical role in both the early and late phases of the IFNA/B gene induction (PubMed:16846591, PubMed:16979567, PubMed:20049431). Found in an inactive form in the cytoplasm of uninfected cells and following viral infection, double-stranded RNA (dsRNA), or toll-like receptor (TLR) signaling, is phosphorylated by IKBKE and TBK1 kinases (PubMed:16846591, PubMed:16979567, PubMed:20049431). This induces a conformational change, leading to its dimerization and nuclear localization and association with CREB binding protein (CREBBP) to form dsRNA-activated factor 1 (DRAF1), a complex which activates the transcription of the type I IFN and ISG genes (PubMed:16846591, PubMed:16979567, PubMed:20049431). Can activate distinct gene expression programs in macrophages and can induce significant apoptosis in primary macrophages (PubMed:16846591, PubMed:16979567, PubMed:20049431).UniProtKB/Swiss-Prot Function
Transcript Variant: This variant (1) represents the protein-coding transcript.
Reviews
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Documents
Resources
"NM_016849" in other vectors (4)
SKU Description Size Price
MG206641 Irf3 (tGFP-tagged) - Mouse interferon regulatory factor 3 (Irf3) 10 ug
$886.00
MR206641 Irf3 (Myc-DDK-tagged) - Mouse interferon regulatory factor 3 (Irf3) 10 ug
$686.00
MR206641L3 Lenti ORF clone of Irf3 (Myc-DDK-tagged) - Mouse interferon regulatory factor 3 (Irf3) 10 ug
$986.00
MR206641L4 Lenti ORF clone of Irf3 (mGFP-tagged) - Mouse interferon regulatory factor 3 (Irf3) 10 ug
$986.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.