OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

Vdr (NM_009504) Mouse Untagged Clone

Be the first to review this product
SKU
MC207441
Vdr (untagged) - Mouse vitamin D receptor (Vdr), (10ug)
Interest in protein/lysate? Submit request here!
ORF Plasmid:
Tag Free tGFP DDK
  $686.00
In Stock*
Bulk Requests & Clone Modifications

Frequently Bought Together (2)

PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "Vdr or NM_009504"

Specifications
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Vdr
Synonyms Nr1i1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>MC207441 representing NM_009504
Red=Cloning site Blue=ORF

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGAGGCAATGGCAGCCAGCACCTCCCTGCCTGACCCTGGTGACTTTGACCGGAATGTGCCTCGGATCT
GTGGAGTGTGTGGAGACCGAGCCACGGGCTTCCACTTCAACGCTATGACCTGTGAAGGCTGCAAGGGTTT
CTTCAGGCGGAGCATGAAGCGCAAGGCCCTGTTCACCTGCCCCTTCAATGGAGATTGCCGCATCACCAAG
GACAACCGGCGACACTGCCAGGCCTGCCGGCTCAAACGCTGCGTGGACATTGGCATGATGAAGGAGTTCA
TCCTCACAGATGAGGAGGTGCAGCGTAAGCGAGAGATGATCATGAAGAGGAAGGAGGAAGAGGCCTTGAA
GGACAGTCTGAGGCCCAAGCTGTCTGAGGAGCAACAGCACATTATCGCCATCCTGCTCGATGCCCACCAC
AAGACCTACGACCCCACCTATGCCGACTTCCGGGACTTCCGGCCTCCAATTCGTGCAGACGTAAGTACAG
GGAGCTATTCTCCAAGGCCCACACTCAGCTTCTCCGGAGACTCCTCCTCAAACTCTGATCTGTACACCCC
CTCACTGGACATGATGGAACCGGCCAGCTTTTCCACGATGGATCTGAATGAAGAAGGCTCCGATGACCCC
TCTGTGACCCTGGACCTGTCTCCGCTCTCCATGCTGCCCCACCTGGCTGATCTTGTCAGTTACAGCATCC
AAAAGGTCATCGGCTTTGCCAAGATGATCCCTGGCTTCAGGGACCTCACCTCTGATGACCAGATTGTCCT
GCTTAAGTCAAGTGCCATTGAGGTGATCATGTTGCGCTCCAACCAGTCTTTTACCTTGGATGACATGTCC
TGGGACTGTGGCAGCCAAGACTACAAATATGACATCACTGATGTCTCCAGAGCTGGGCACACCCTGGAGC
TGATCGAACCCCTCATAAAGTTCCAGGTGGGGCTGAAGAAGCTGAACCTCCATGAGGAAGAACATGTGCT
GCTCATGGCCATCTGCATTGTCTCCCCAGACCGACCTGGGGTACAGGATGCTAAGCTGGTTGAAGCCATT
CAGGACCGCCTATCCAACACACTGCAGACCTACATCCGCTGCCGCCACCCGCCCCCGGGCAGCCACCAGC
TCTACGCCAAGATGATCCAGAAGCTGGCTGACCTGCGAAGCCTCAATGAGGAGCACTCCAAACAGTACCG
TTCCCTCTCCTTCCAGCCGGAGAACAGCATGAAGCTCACACCCCTTGTGCTAGAGGTGTTCGGCAATGAG
ATCTCCTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Chromatograms Chromatograms
Sequencher program is needed, download here
Restriction Sites SgfI-MluI |
ACCN NM_009504
Insert Size 1269 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq BC006716, AAH06716
RefSeq Size 3328 bp
RefSeq ORF 1269 bp
Locus ID 22337
UniProt ID P48281
Cytogenetics 15 F1
Summary Nuclear receptor for calcitriol, the active form of vitamin D3 which mediates the action of this vitamin on cells (By similarity). Enters the nucleus upon vitamin D3 binding where it forms heterodimers with the retinoid X receptor/RXR (By similarity). The VDR-RXR heterodimers bind to specific response elements on DNA and activate the transcription of vitamin D3-responsive target genes (By similarity). Plays a central role in calcium homeostasis (By similarity).UniProtKB/Swiss-Prot Function
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_009504" in other vectors (6)
SKU Description Size Price
MG206711 Vdr (tGFP-tagged) - Mouse vitamin D receptor (Vdr) 10 ug
$886.00
MR206711 Vdr (Myc-DDK-tagged) - Mouse vitamin D receptor (Vdr) 10 ug
$686.00
MR206711L1 Lenti ORF clone of Vdr (Myc-DDK-tagged) - Mouse vitamin D receptor (Vdr) 10 ug
$986.00
MR206711L2 Lenti ORF clone of Vdr (mGFP-tagged) - Mouse vitamin D receptor (Vdr) 10 ug
$986.00
MR206711L3 Lenti ORF clone of Vdr (Myc-DDK-tagged) - Mouse vitamin D receptor (Vdr) 10 ug
$986.00
MR206711L4 Lenti ORF clone of Vdr (mGFP-tagged) - Mouse vitamin D receptor (Vdr) 10 ug
$986.00

file-alt Citations

Cell-based and in silico evidence against quercetin and structurally-related flavonols as activators of vitamin D receptor
Lau, Politi, Yang et al
J. Steroid Biochem. Mol. Biol. (2016)
Cited by 7
AI Summary: OriGene products, specifically the VDR expression plasmids (pCMV6-entry-rVDR, pCMV6-entry-mVDR, and pCMV6-XL4-hVDR) and their corresponding control plasmids, were used to express vitamin D receptors in cells for testing the effects of quercetin and related flavonols in this study.
Snippet: 2.2. Plasmids. VDR expression plasmids (pCMV6-entry-rVDR, pCMV6-entry-mVDR, pCMV6-XL4-hVDR) and their corresponding control plasmids (pCMV6-entry and pCMV6-XL4) were bought from OriGene Technologies, Inc. (Rockville, MD, USA). ... Cite SaveSaving
Showing 1-1 of 1 papers.
Powered by BizGenius
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products