OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

Fgr (NM_010208) Mouse Untagged Clone

Be the first to review this product
SKU
MC205903
Fgr (untagged) - Mouse Gardner-Rasheed feline sarcoma viral (Fgr) oncogene homolog (Fgr), (10ug)
Interest in protein/lysate? Submit request here!
ORF Plasmid:
Tag Free tGFP DDK
AAV Particle:
DDK
  $482.00
In Stock*
Bulk Requests & Clone Modifications

Frequently Bought Together (3)

CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "Fgr or NM_010208"

Specifications
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Fgr
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>BC057863
GTCGCCCCAGATCGAGTCACCCGCAGCTGGCTCCCTTGAGACCAGGTTTCCGGCACCTCCCAGGGATCAT GCATCAGTCCTATTGACCCAGGAGTAGGGGTCTGTGGGGGCATCTGGAATGGGCTGTGTGTTCTGCAAGA AGTTGGAGCCTGCATCCAAGGAGGATGTGGGCCTGGAAGGGGACTTCCGGAGCCAAACGGCTGAAGAACG CTATTACCCTGACCCCACTCAAGGCCGGACTTCGTCCGTCTTTCCTCAGCCCACCAGCCCTGCTTTCCTC AACACTGGCAACATGAGAAGCATCTCAGGGACCGGAGTGACCATATTCGTCGCCCTGTACGACTATGAGG CCAGGACAGGGGATGACCTCACCTTCACCAAAGGCGAGAAGTTCCACATCCTGAACAATACGGAGTATGA CTGGTGGGAGGCTCGCTCCCTGAGCTCCGGACACAGAGGCTATGTTCCCAGCAACTATGTTGCTCCTGTG GATTCCATCCAGGCTGAAGAGTGGTACTTCGGAAAGATCAGTAGAAAGGATGCAGAGAGGCAGCTTCTGT CCTCTGGTAACCCCCAGGGGGCCTTTCTCATTCGGGAAAGCGAGACCACCAAAGGGGCCTACTCCCTGTC CATCCGTGACTGGGACCAGAACAGAGGCGATCACATAAAGCATTATAAGATCCGAAAGCTGGACACGGGC GGCTACTACATCACCACACGGGCCCAGTTTGACTCCATACAGGACCTAGTGCGGCACTACATGGAAGTGA ATGATGGTCTGTGCTACTTGCTTACGGCGCCTTGTACCACCACTAAGCCCCAGACTCTAGGCCTGGCCAA GGATGCCTGGGAGATCGACCGGAACTCCATAGCACTGGAACGCAGGCTGGGCACCGGCTGCTTTGGAGAT GTGTGGCTGGGCACATGGAACTGCAGCACAAAGGTGGCAGTGAAGACGCTGAAGCCGGGCACCATGTCCC CGAAGGCATTCCTGGAGGAGGCACAGATCATGAAGCTGCTGAGGCACGACAAGCTGGTGCAGCTGTATGC GGTGGTGTCGGAGGAACCCATTTATATTGTGACAGAGTTCATGTGCTATGGTAGCTTGCTGGATTTCCTA AAGGATCGAGAAGGTCAGAACTTGATGCTGCCCCATCTAGTGGACATGGCTGCCCAGGTAGCCGAGGGCA TGGCCTACATGGAACGCATGAACTATATCCACCGAGACTTGAGGGCAGCCAACATCCTGGTGGGGGAATA CCTAATATGCAAGATCGCTGACTTCGGGCTGGCACGCCTCATAGAGGACAATGAGTATAACCCCCAACAA GGAACCAAGTTCCCCATCAAGTGGACAGCCCCAGAGGCCGCCCTCTTTGGCAGATTCACTGTCAAATCAG ACGTGTGGTCCTTTGGGATTCTGCTCACTGAACTGATCACCAAGGGCAGAGTTCCCTACCCAGGTATGAA CAACCGGGAAGTGTTGGAACAGGTGGAGCATGGCTACCACATGCCGTGCCCTCCAGGATGTCCTGCATCC CTGTATGAGGTCATGGAGCAGGCCTGGCGCCTGGATCCAGAGGAGAGGCCCACCTTTGAGTACCTGCAGT CTTTCCTGGAAGACTATTTCACCTCCACAGAACCACAGTACCAGCCTGGAGACCAGACATAGCCTGACTG GGCATCACTGACCCTCTGGGAGTTTGTACTTGGTCTTGCCAATCCCCCGGGGCACTCTGGTCCCAGTGCC CAAGACTTGGAACCCCTGTGGAATCCTAGCACAGGATCAGAGAAGGTCCGACGCTCTGAAGCCATTTTAT AGAGGGTGCAAATGGAGACGAGAAACTCATCTCTTAAAAAAAAAAAAAAAAAA
Restriction Sites RsrII-NotI |
ACCN NM_010208
Insert Size 1554 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq BC057863, AAH57863
RefSeq Size 1873 bp
RefSeq ORF 1554 bp
Locus ID 14191
UniProt ID P14234
Cytogenetics 4 66.11 cM
Summary Non-receptor tyrosine-protein kinase that transmits signals from cell surface receptors devoid of kinase activity and contributes to the regulation of immune responses, including neutrophil, monocyte, macrophage and mast cell functions, cytoskeleton remodeling in response to extracellular stimuli, phagocytosis, cell adhesion and migration. Promotes mast cell degranulation, release of inflammatory cytokines and IgE-mediated anaphylaxis. Acts downstream of receptors that bind the Fc region of immunoglobulins, such as MS4A2/FCER1B, FCER1G and FCGR2. Acts downstream of ITGB1 and ITGB2, and regulates actin cytoskeleton reorganization, cell spreading and adhesion. Depending on the context, activates or inhibits cellular responses. Functions as negative regulator of ITGB2 signaling, phagocytosis and SYK activity in monocytes (PubMed:11672534). Required for normal ITGB1 and ITGB2 signaling, normal cell spreading and adhesion in neutrophils and macrophages (PubMed:8666673 and PubMed:9687507). Functions as positive regulator of cell migration and regulates cytoskeleton reorganization via RAC1 activation (PubMed:15561106). Phosphorylates SYK (in vitro) and promotes SYK-dependent activation of AKT1 and MAP kinase signaling (PubMed:21746961). Phosphorylates PLD2 in antigen-stimulated mast cells, leading to PLD2 activation and the production of the signaling molecules lysophosphatidic acid and diacylglycerol. Promotes activation of PIK3R1. Phosphorylates FASLG, and thereby regulates its ubiquitination and subsequent internalization. Phosphorylates ABL1. Promotes phosphorylation of CBL, CTTN, PIK3R1, PTK2/FAK1, PTK2B/PYK2 and VAV2. Phosphorylates HCLS1 that has already been phosphorylated by SYK, but not unphosphorylated HCLS1.UniProtKB/Swiss-Prot Function
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_010208" in other vectors (4)
SKU Description Size Price
MG208281 Fgr (tGFP-tagged) - Mouse Gardner-Rasheed feline sarcoma viral (Fgr) oncogene homolog (Fgr) 10 ug
$682.00
MR208281 Fgr (Myc-DDK-tagged) - Mouse Gardner-Rasheed feline sarcoma viral (Fgr) oncogene homolog (Fgr) 10 ug
$289.00 $482.00
MR208281L3 Lenti ORF clone of Fgr (Myc-DDK-tagged) - Mouse Gardner-Rasheed feline sarcoma viral (Fgr) oncogene homolog (Fgr) 10 ug
$782.00
MR208281L4 Lenti ORF clone of Fgr (mGFP-tagged) - Mouse Gardner-Rasheed feline sarcoma viral (Fgr) oncogene homolog (Fgr) 10 ug
$782.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products